"नये भारत का नया Tender Portal"
Gem Bids For Onco, No 2 Obq 0 Monofilament Polydioxanone Pds Suture Violet70 To 80Cm 1 Obq 2 Circle 30 To 40Mm Round Bodied Needlebis Box Of 12 No 3 Obq 0 Monofilament Polydioxanone Pdssuture Violet Length 70 To 80Cm 1 Obq 2 Circle 30 To 40Mmround Bodied Needle Box Of 12 No 4 Obq 0 Monofilamentpolydioxanone Pds Suture Violet Length 70 To 80Cm 1 Obq 2Circle 20 To 25Mm Round Bodied Needle Box Of 12 No 5 Obq0 Monofilament Polydioxanone Pds Suture Violet Length 40To 50Cm 15 To 20Mm 1 Obq 2 Circle Round Body Needle Bisand Equivalent Box Of 12 Black Braided Silk Withneedle Suture 3 Obq8 Circle Reverse Cutting 45 Mmlength 76 Cm Size 2 Obq 0 Pack Of 12 Obqbox Usfda Synthetic Absorbable Polyglactin Coated 1 Obq2circle Round Body 16 Mm Braided Length 70 Cm Size 4 Obq0 Pack Of 12 Obqbox Usfda Skin Marking Pen Thickmarking With A Flexible Scale Sterile Peel Open Pouch Vascular Tapes Red Vascular Tapes Blue Monofilamentpolyglecaprone Absorbable Suture Size 3Obq 0 70 To 90 Cm1 Obq2 Circle Taper Cutting 20 To 30 Mm Needle Eu Bis Andequivalent Box Of 12 Aami Level 3 Reinforcedperformance Sterile Surgical Gown Consists Of Five Layersfsms Fabric With Two Hand Towel Bipolar Disposablecautery Leads Vascular Chemport 9Point6 Fr Mricompatible With One Way Valve With Introducer Kit Bovinecollagen Patch Coated With Synthetic Sealant Nhs Peg 27Mmx27 Mm Bovine Collagen Patch Coated With Syntheticsealant Nhs Peg 45 Mmx45 Mm Monopolar Handswitchingdisposable Sterile Pencil Disposable Sterile Monopolarcautery Leads Plug Connector 3 Pin Banana Plug Control Basic Drape Pack Disposable Sterile Drape Set For Head Andneck Surgeries Breast Prosthesis External Silicone Teardrop Shaped With Under Arm Extension In Light Weight Ariantassorted Sizes With Two Bras Having Two Pouches Each Bid Number Gem2025b6692939 Dated 11-10-2025 Bid Document1 46 0 0 Linear Cutter Stapler 60Mm With Interchangeable Cartidgesto Accommodate And Use Different Colour Reloads Withtristaple Technology, Linear Cutter Stapler 80Mm Withinterchangeable Cartidges To Accommodate And Usedifferent Colour Reloads With Tristaple Technology, Linearcutter Stapler Reloads With Inbuilt New Knife And With Threedifferent Leg Length 3Point0mm 3Point5mm And 4Point0mmstaple Lines, Reusable Clip Applicator For Open Surgerycompatible With Ligaclip 300, Reusable Clip Applicator Foropen Surgery Compatible With Ligaclip 400, Titanium Linearcutter 75Mm Selectable Staple Height Of 1Point5 To 1Point82point0mm Titanium Mri Compatible In One Cartridge, Circular Wound Protector Obqretractor With Flexibleretraction Ring Small Incision Size 2Point5 To 6 Cm Pack Of 5, Closed Wound Suction Drain Unit With 02 X Perforated Pvcdrain With 01 Trocar 01 Spring Loaded Bellows Andconnecting Tubing Size 12 Fr, Breathabe Reinforced Highperformance Aami Level 4 Sterile Surgical Gown Soft Knittedv Neck Collar Consists Of Five Layer Sfsms Non Woven Fabric, Universal Pack Minor With Short Side Drapes Containing Topdrape 276Cm X 149Cm Bottam Drape 165Cm X 193Cm Sidedrape 2 83Cm X 114Cm, Universal Pack Contain 1 Outerwrap 90 Cm X 90 Cm 1 Suture Bag 1 Bottom Drape Withcontrol Reinfrocement 193 Cm X 193Cm 1 Top Drape, Greenreloads 2Point0mm Close Staple Height With Gripping Surfacetechnology Compatible With Present Powered Stapler 45Mm, Powered Vascular Stapler 35 45Mm With Narrower Curvedand Blunt Tip Anvil With Thinner Shaft Offering Greatest Angleof Reach, Double Lumen Pvc Plastic Tracheostomy Tube Withlow Pressure Cuff And Speaking Valve With 360 Degreefreedom At Neck Flange Size 7Mm Id, Double Lumen Pvcplastic Tracheostomy Tube With Low Pressure Cuff Andspeaking Valve With 360 Degree Freedom At Neck Flange Size7point5 Mm Id, Double Lumen Pvc Plastic Tracheostomytube With Low Pressure Cuff And Speaking Valve With 360Degree Freedom At Neck Flange Size 8Mm Id, Knotlesstissue Control Device Synthetic Absorbable Polydioxanonewith Antibacterial Triclosan Coated 1 Obq2 Circle Taper Point26mm Unidirectional, Knotless Tissue Control Device 1 Obq2circle Taper Point Sh26 Mmpolydioxanone Withtriclosan Unidirectional With Fixation Tab 45Cm Size 3 Bq0, Knotless Tissue Control Device Synthetic Absorbablepolydioxanone With Antibacterial Triclosan Coated 1 Obq2circle Taper Point 40Mm Unidirectional With Fixation Tab45cm Size 1 Box Of 12, Laparotomy Drape With Incise76inpoint X 120 In 193Cm X 305Cm Fenestration Having Smscontrol Plis Fabric Reinforcement Meets The Ammi, Laparoscopic Endobag Retrieval Device Large 300 Ml, Laparoscopic Endobag Retreival Device Medium 200 Ml, Laparoscopic Disposable Veress Needle 120Mm, Moldableskin Barrier Hydrocolloid Flexible Collar Colostomy Obqurostomy Set Cinsist Of Wafer 10 Nos Flange 10 Nos Stomapaste 02 Powder 01 Belt 01 Size 57 Mm, Moldable Skinbarrier Hydrocolloid Flexible Collar Colostomy Obq Urostomyset Cinsist Of Wafer 10 Nos Flange 10 Nos Stoma Paste 02Powder 01 Belt 01 Size 70 Mm, Polyglyconate Absorbableunidirectional Barbed Suture 3Obq 0 17Mm Taper Point 1Obq2 Circle 15Cm Box Of 12, Polyglyconate Absorbableunidirectional Barbed Suture 2 0 26Mm Taper Point 1 Obq2circle 30Cm Box Of 12, Single Lumen Pvc Plastictracheostomy Tube With Low Pressure Cuff Size 7Point0 Mmid, Single Lumen Pvc Plastic Tracheostomy Tube With Lowpressure Cuff Size 7Point5mm Id, White Reload 1Point0mmclose Staple Height With Gripping Surface Technology //Bid Details2 / 46 Compatible With Present Powered Stapler 60Mm, Sterilepowder Free Latex Micro Surgical Gloves Iso Obqen Obqastmcertified Viral Resistance Tested Light Brown Size 7Point0, Reusable Insulated Smoot Tip Stainess Steel Foot Switchingbiopolar Coagulation Forceps Hardy Bayonet Forceps Withstops 20Point9 Cm 8Point25, Reusable Insulated Smoot Tipstainless Steel Foot Switching Bipolar Coagulation Forcepssemkin Forceps With Stops 14Cm 5Point5 In Tip 0Point5mm, Disposable Automatic And Semi Automatic Core Biopsy Gun12gx10 And 16Cm Length With A Dual Adjustable Penetrationdepth Of 18Mm, Disposable Automatic And Semi Automaticcore Biopsy Gun 14G X10 And 16 Cm Length With Adjustablepenetration Depth Of 18 Mm And 25 Mm, Disposableautomatic And Semi Automatic Core Biopsy Gun 16Gx10 And16cm Length With A Dual Adjustable Penetration Depth Of18mm And 25Mm, Disposable Automatic And Semiautomatic Core Biopsy Gun 18G X10 16 And 20 Cm Lengthwith Adjustable Penetration Depth Of 18 Mm And 25 Mm, Incise Drape Made Up Of Polyester Film With An Acrylicadhesive That Contains A Complex Of Iodoform N Vinyl 2Pyrrolidine With A Iodine Concentration, Sterile Indocyaninegreen Usp 25 Mg Lyophilized Powder For Iv Obq Intraocularuse Vial And 5 Ml Sterile Distilled Water With Sterile Singleuse Syringe Filter 0Point2 Micron, Polyamide Monofilamentsize 3 Obq0 70 100Cm 3 Obq8 Circle Reverse Cutting 2530Mm Box Of 12 Foils, Synthetic Oxidized Re Generatedcellulose Double Layered With Peg And Trilysine Size 2 Into 4Cm, Synthetic Oxidized Re Generated Cellulose Doublelayered With Peg And Trilysine Size 5 Into 5 Cm, Syntheticoxidized Re Generated Cellulose Double Layered With Peg Andtrilysine Size 5 Into 10 Cm
Custom Dna Synthesis Of Primers 25 Nmol , Prime Script 1st Strand Cdna Synthesis Kit 50 Reactions , Tb Green Pre Mix Ex Taq Ii Tli Rnase H Plus , Rnaiso Plus Total Rna Extraction Reagent , Amylase From Bacillus Licheniforms , Amyloglucosidase From Aspergillus Niger Lyophilized Powder 70 U Mg , Glucose Oxidase Form Aspergillus Niger Type Vii Lyophilized Powder 100000 Units G Solid Without Added Oxygen , Peroxidase From Horseradish Type Ii Essentially Salt Free Lyophilized Powder 150 250 Units Mg Solid Using Pyrogallol , Primers Forward Revers Total Base 1249 , Fish Immunoglobulin M Ig Elisa Kit 96t , Superoxide Dismutase Sod Elisa Kit , Fish Lysozyme Renal Amyloidosis Lzm Elisa Kit , Fish Interleukin 6 Il 6 Elisa Kit , Fish Cortisol Elisa Kit , Forward Primers , Reverse Primer , Taq Dna Polymerase , Ezassay Antioxidant Activity Estimation Kit Cuprac 200 Tests , Azo M Protein Azo Casein , Ezdetect Pcr Kit For Mycoplasma Detection Based On 16s 23s Rrna Spacer Region , Trypsin Inhibitor Powder Source Soyabean Cell Culture Tested Activity 7000baee Units Of Inhibition Mg , Coif1 5tcaaccaaccacaagacattggcac3 26 Nucleotides , Coir1 5tagacttctgggtgccaaagaatca3 26 Nucleotides , M151 5aacccggctttcggcagca3 20 Nucleotides , M152 5cggggcggggttgtgagat3 20 Nucleotides , Ihn Up F 5agagatccctacaccagagac 3 21 Nucleotides , Ihn Up R 5agagatccctacacagagac 3 21 Nucleotides , Vn F 5atggaaggaggaatcgtgaagcg 3 24 Nucleotides , Vn R 5
Supply Of Running Contract For Inj.lyophilized Powder Contains Follitropin Alfa Recombinant Dna Follicle Stimulating Hormone 75 Iu 5.5mcg In Vial Packing..
Supply Of Running Contract For Inj.lyophilized Powder Contains Follitropin Alfa Recombinant Dna Follicle Stimulating Hormone 75 Iu 5.5mcg In Vial Packing..
Gem Bids For Span80, Tannic Acid, 6 Aminocaproic Acid, Rpmi1640medium, With Glutamine, Mem Eagle At017, Hyaluronic Acid, Calcium Chloride Fused L R 500gm, Dextrin White, Dextran From Leuconostoc Sp, Minocycline Hydrochloride, Span 80, Acetic Acidglacial, Glycerine, Paraffin Liquid Light, N-hexane, Toluene, Bovine Serum Albumin, Paraformaldehyde, Collagenase From Clostridium, Pepsin Lyophilized Crystalline Powder
Supply Of Itab. Telmisartan 40 Mg + Amlodepin 5 Mg +chlorthalidone 6.25mg Iitab. Methylcobalamine 1500 Mcg. Iiitab/cap. Tacrolimus 0.25 Mg Iv Inj.vincristin 1 Mg Vinj. Bendamustine Ip 100mg Lyophilized Inj. Bendamustine Ip 100mg Lyophilized Powder.
Gem Bids For Topical Lignocaine Xylocaine, Diazepam Oral Liquid, Adrenaline Inj 1mg Ml, Cetrizine Hydrochloride Tab 10mg, Chlorpheniramine Maleate Tab 4mg, Paracetamol Tab500mg, Paracetamol Tab 650mg, Paracetamol Drops 15ml, Paracetamol Syrup 60ml Bottle, Diclofenac Sodium 25mgml Inj, Diclofenac Sodium Tab 50mg, Ibuprofen Tab 200mg, Ibuprofen Tab 400mg, Ibuprofen Syrup 60ml Bottle, Lignocaine With Hydrocortisone, Zinc Oxide Cream 20gm, Amoxycillin Cap 250mg, Amoxycillin Cap 500mg, Amoxycillin Syrup 250mg, 60ml Bottle, Gentamycin Inj10mg 2ml, Gentamycin Inj 40mg 2ml, Ciprofloxacin Tab250mg, Ciprofloxacin Tab 500mg, Metronidazole Tab200mg, Metronidazole Tab 400mg, Fluconazole Tab100mg, Diethylcarbamazine Citrate Tab I P 50mg, Diethylcarbamazine Citrate Tab I P 100mg, Albendazole Tab400mg, Primaquine Tab 2 5mg, Primaquine Tab 7 5mg, Primaquine Tab 15mg, Artesunate Tab 50mg, Artesunatetab 200mg, Glyceryl Trinitrate Sublingual Tabs 0 5mg, Isosorbide Dinitrate Tab 5mg, Isosorbide Dinitrate Tab10mg, Atropine Inj 0 6mg Ml, Enalapril Tab 2 5mg, Enalapril Tab 5mg, Amlodepin Tab 2 5mg, Amlodepin Tab5 Mg, Amlodepin Tab 10 Mg, Atenelol Tab 50mg, Ateneloltab 100mg, Frusemide Tab 40mg, Metformin Tab 500mg, Metformin Tab 750mg, Metformin Tab 1000mg, Glimiperide 1mg Tab, Glimiperide 2mg Tab, Salbutamoltab 2mg, Salbutamol Tab 4mg, Salbutamol 200mcgrotacaps Powder Puff, Salbutamol Syrup 2mg 5ml, 100ml, Xylometazoline Nasal Drops, Rotahalers, Phenobarbitonetab 30mg, Phenobarbitone Tab 60mg, Phenobarbitonesyrup 20mg 5ml, 60ml Bottle, Phenytoin Tab 50mg, Phenytoin Tab 100mg, Phenytoin Tab 300mg, Phenytoininj 50mg Ml, Phenytoin Sodium Er Tablet 300 Mg, Sodiumvalporate Tab 200mg, Sodium Valporate Tab 500mg, Carbamezapine Tab 100mg, Cap Mefenamic Acid 250mg, Cap Mefenamic Acid 500mg, Acetyl Salicylic Acid Tab150mg I P, Acetyl Salicylic Acid Tab 300mg I P, Clopidogreltab 75mg, Vitamin K3 Water Soluble Inj, Antisnake Venomserum Strerile Powder With Strerile Water, Lyophilized Sterilesolution 10ml, Human Insulin Plain 40iu Ml, Human Insulinnph Isophane 40iu Ml, Cholecalciferol 1000 Iu Granulessachet, Cholecalciferol 60000 Iu Granules Sachet 1gm, Hydrocortisone Sodium Succinate Inj 100mg, Dexamethasone Inj 4mg Ml, Water For Injection 5ml, Waterfor Injection 10ml, Ferrous Fumarate Syrup 100ml Bottle, Folic Acid Tab 400mcg, Folic Acid Tab 5mg, Iron Folic Acidtab 100 Mg, Vitamin A Capsule 5000 Iu, Vitamin Acapsule 50000 Iu, Vitamin A Capsule 100000 Iu, Vitamin Aconcetrated Solution 100ml, Ascorbic Acid Vitamin C100mg, Ciprofloxacin Eye Ear Drop 5ml, Sodium Chlorideeye Drop, Clotrimazole Ear Drops 10ml, Boro- Spirit Eardrops 5ml, Liquid Paraffin Menthol Drops 100ml, Chlorpheniramine Syrup, Activated Charcoal Oral, Injpralidoxime Chloride 500 Mg, Inj Pralidoxime Chloride 1 Gm, Spironolactone Tab 25mg, Spironolactone Tab 50mg, Propranolol Tab 10mg, Propranolol Tab 40mg, Propranololtab 80mg
Supply Of Running Contract For Inj.lyophilized Powder Contains Follitropin Alfa Recombinant Dna Follicle Stimulating Hormone 75 Iu 5.5mcg In Vial Packing..
Gem Bids For Boq, 4260 Rifaximin Tablet 400 Mg 3521 Pirfenidone 200 Mg Tab 2306 Spironolactone 25 Mg Tab 2769 Digoxin 025 Mg Tab 2781 Nimodipine 30 Mg Tab 2420 Pentoxifylline 400 Mgtab Midodrine Hydrochloride 5 Mg 4635 Metolazone 5mgtablet 2792 Empagliflozin 25mg 2787 Pyridoxine 50 Mgtab 2356 Vitamina 25000 I U Cap 2682 Cabergoline 0 5mgtab Deferiprone Kelfer 250 Mg Capsules 1760 Ordinarydenatured Spirit 500 Ml 1018 Fat Emulsion I V 20parsentage 600ml To 1300 Ml Bag 1022 Haemodialysisfluid Concentrated 10 Ltrs Plastic Can 1024 Fat Emulsion I V20 Parsentage 250 Ml Bot 1046 Haemodialysis Concentratebicarbonate Powder Pharmacopoeal Grade Iso C E Cerfiedpart A And B Are In Powder Form Acetum Acetic Acid Is Inliquid Form Packet 1107 Multiple Electrolytes And Dextroseinjection Type 2 Usp 500 Ml Bot 1111 Multiple Electrolytesand Dextrose Injection Type 1 Usp 500 Ml Bot Peadiatric 112 Fat Emulsion Iv 20 Parsentage 1500 Ml Bag Amino Acidglucose Tpn Total Parentral Nutrition 1633 Hydroxyethylstarch I V 200 0 5 6 Parsentage 500 Ml Bot Peaditaricperitoneal Dialysis Fluid Ip 500 Ml Bottle 1123 Surfactantfor Intratrecheal Actant Minimum Labelled Shelf Life Inmonths 18 5ml 1336 Ketoraloc Eye Drop 5ml Vial 1487moxifloxacin 05 Parsentage With Prednisolone 1 Parsentageeye Drop 5ml Vial 1569 Hydrocortisone Acetate 1parsentage W W Skin Cream 5gm Tube 1696 -phenobarbitone Sodium Syrup 60 Ml Bottle 1718 Atropinesulphate 1 Parsentage Ointment 1769 Valproate Sodium200 Mg 5ml Syrup 100ml Bottle 1770 Promethazine Syrup60 Ml Bottle 1968 Framycetin 1 Parsentage W W Cream30gm Tube 3550 Budesonide 200mcg Formoterol Fumarate6mcg Inhaler 3561 Salbutamol Inhalation 100 Mcgdose 3575 Silver Sulphadiazine 1 Parsentage W W Ointment250gm 4124 Naphazoline 005 Parsentage W V Bid Number Gem2025b6591271 Dated 26-08-2025 Bid Document1 117 1 1 Phenylephrine 0.12 Parsentage W V Eye Drop 10ml, 1627 Injbenzathin Peni 12 Lakhs Units, 1425 Inj Benzyl Peni 10 Lakhsunits, 2154 Inj Diazepam 5 Mgml 2 Ml Amp, 1675 Injisoxsuprin 5 Mg Ml 2 Ml Amp, 1593 Inj Neostigmin 0 5 Mgml 1 Ml Amp, 1963 Inj Rocuronium 50 Mg 5 Ml, 2111 Injlorazepam 2 Mg Ml 2 Ml Amp, 2113 Inj Midazolam 1 Mgml5 Ml, 1547 Inj Daltaparin 5000 Iu 0 2 Ml Antifactor, 4674 Injtorsemide 10 Mg Ml 2 Ml Amp, 4261 Inj Vasopressin 20 Iuml 1 Ml Amp, Inj Insulin Aspart Pre Filled Pen Novarapid Flexpen, 3532 Inj Insulin Aspart 100 U Ml 10 Ml Vial, 1119 Injaqueous Sol Of Haemocoagulase 1 Ml Botrophase, 1027 Injcontrast Media Mri Gadolinium, 1106 Inj Contrast Non Ionicmonomer 370 Mg Ml Iopamidol 100 Ml Bottle, 1403 Injhyaluronidase 1500 Iu Powder 2 Ml Vial, 1715 Inj Phenemaleate 22 75 Mg Ml 2 Ml Amp, 3531 Inj Tocilizumab 400mg 20 Ml, 3530 Inj Tocilizumab 200 Mg 20 Ml, 2253dinoprostone 0 5mg Gel 1ut, Inj Cloxacilline 500 Mg, Injcaffeine Citrate 20 Mg Ml 1 Ml Vial Capnea, Injsugammadex 100 Mg Ml 2 Ml Vial, Inj Epitrate 1 Ml, Injphenocaine Plus 1 Ml, Inj Chlorpromazine 25 Mg, Injesmolol 10 Ml, Inj Ramifentanil 2 Mg, Inj Levobupivacaine 05 Parsentage Isobaric 4 Ml Amp 20 Mg Neon, Amphotericinb 50mg Injection Powder Form, Indocyanine Green Uspsterile Powder 25 Mg Lyophilized, 2564 Tigicycline 50mg Inj, Tigicycline 100 Mg Inj, Morphine 10 Mg, Paracetamol 650mg, Tramadol 50 Mg, Tapentadol 50 Mg, 4398 Etoricoxib60mg Tablet, 4503 Celecoxib 200mg Capsule, 4400gabapentin 300 Mg Tablet, 4711 Pregabalin 75mg Capsule, Domperidone 10mg Paracetamol 325mg Tramadol 37.5mg, Inj Remdesivir 100mg, Syp Kesol Potssium Chloride Solution200 Ml Bottle, Syp Cital Disodium Hydrogen Citrate 100 Ml, Deferiprone Kelfer 500 Mg Capsules, Deferasirox 250 Mgtab, Deferasirox 500mg Tab, Hypersol 6 Eye Ointmentsodium Chloride, Levetiracetam Syp 100 Ml 100mg Ml, Griseofoulvin 250, Injection Valthamet Bromide 8mg Mlamp, Drop Bromfenac 0 09parsentage Wv Moxifloxacin 05parsentage Wv Eye Drop 5 Ml, Inj Voriconazole 200mg Vial, Cyclosporine Oral Solution Usp 100 Mg 50 Ml Bottle, Injetomidate 2 Mg Ml 10 Ml, Inj Sodium Tetradecyl Sulphate60 Mg 2 Ml 2 Ml Amp, Inj Mitomycin 40mg, Pyridoxinevitamin B6 40 Mg, Inj Ampicillin 1 Gm Sulbactam 0 5 Gm, Injampicillin Cloxacillin 500 Mg, Inj Vitamin D3 6 Lac, Norethisterone 5mg Tablet, Mifepristone 200 Mg Tab, Nicotinamide 200mg Ml Folic Acid 15mg Ml Cyanocobalamin500mcg Ml, Voriconazole 200mg Inj, Valethamate 8mg Inj, Danazol 200mg Capsule, Amphotericin B 100mg Liposomeinjection, Drotaverine 40mg Injection, Clobazam 5mg Tab, Albumin 20parsentage 20gm 100 Ml 100 Ml, Sodiumtetradecyl Sulphate 30mg Ml 2 Ml Amp, Inj Retiplase Tpa 18mg, Voriconazole 30mg 1 Parsentage W V Eye Drop, Factor9 500 Iu 10 Ml, 2494 Factor Viii Concentrate 250 Iu, Folicacid 0 7mg Methylcobalamin 2500mcg Niacinamide 12mgvitamin C 150mg, 2718 Tab Deferasirox 500mg, Clopidogrel150 Mg, Inj Amoxycillin Clavalunic Acid 600 Mg, Lactic Acidbacillus Sachet, Tab Nitrofurantoin 100 Mg, Prazolam 025mg, Co Enzyme Q 10 Vitamin, Potassium Chloride 1 Mg, Etizolam 0 25 Mg, Nitazoxanide 500, Ibuprofen Andparacetamol, Sacubitril 24 Mg Valsartan 26 Mg, Rivaroxaba10 Mg, Nitrendipine, Syp Cyclosporine 100mg Ml, Capthalidomide 100mg, Rituximab Injection, Tofacitinib 5 Mg, Tab Nicotinamide 250mg, Formoterol Budesonide Inhaler, Benzonatate, Disperzyme, Calcitriol Calcium Cit, Duloxetinehcl 30 Mg Tab, Prazosin Xl 5mg, Mycophenolate Sodium, Alendronic Acid 35 Mg, Ranitidine 150mg, Acityl Salisalic //bid Details2 / 117 Acid 75 Mg, Rifaximine 400 Mg, Glutone Glutone C Tablet, Hydroxyurea 500mg, Ubiquinol Acetate 100 Mg, Transfer5000pfs, Zoledronic Acid 4 Mg, Trimethoprimsulfamethoxazole, Vildagliptin 50mg, Metaprolol, Tabcotrimaxazole Ds, Carvedilol 12 5, Alphacalcidol, Mycophenolate Mofetil 500mg, Methotrexate 7 5mg, Rifaximin 400 Mg, Pirfenidone 200 Mg, Inj Valethamate8mg Ml 1 Ml Amp, Inj Drotaverine Hydrochloride 40 Mg 2 Mlamp, Molecules, Voriconazole 1parsentage E D 5 Ml, Flurbiprofen 0 3 Parsentage E D 5 Ml, Nepafenac 0 1parsentage E D 5 Ml, Proparacaine E D 5 Ml, Atropine 1parsentage E D 5 Ml, Bromfenac E D 5 Ml, Olapatadine 0 1 Ed 5 Ml, Moxifloxacin And Loteprednol E D 5 Ml, Gatifloxacinana Prednisolone E .d 5 Ml, Moxifloxacin 0 5 Parsentga E D5 Ml, Pilocarpine 2 Parsentage E D 5 Ml, Timolol 0 5parsentage E D 5 Ml, Tobramycin 0 3 Parsentage E D 5 Ml, Predforte 1 Parsentgae E D 5 Ml, Moxifloxacin Andbromfenac E D 5 Ml, Carboxy Methyl Cellulose E D 5 Ml, Povidone Lodine 0 5 Parsentage E O 5 Ml, Tropicamide Andphenyephrine E D 5 Ml, Polymixin B And Chloramphenicoloccupol E O 5 Gm, Sodium Chloride Hypersol Eo 5 Gm, Hydroxypropyl Methycellulose Lacrigel E O 5 Gm, Atropinesulphate Eo 5 Gm, Polymixin B Chloramphenicol Anddexamethasone Ccupol Dx E O 5 Gm, Gancyclovir 0 15parsentage Eye Gel 5 Gm, Phenocaine Inj 1 Ml, Intracameral Moxifloxacin Inj 1 Ml, Pilocarpinol Inj 1 Ml, Sodium Hyaluronate 1 Ml, Epitrate Inj 1 Ml, 2159 Injstreptomycin 0 75 Gm, 1693 Inj Ketamine 50 Mg Ml 10 Mlvial, 3541 Inj Lacosamide 200 Mg 20 Ml, 2013 Lignocaine 2parsentage Inj 30ml Vial, 1594 Inj Succinyl Scholine 50 Mgml 10ml, 3543 Inj Midazolam 5 Mg Ml 1 Ml
Gem Bids For Units , 2154 Inj Diazepam 5 Mgml 2 Ml Amp , 1675 Inj Isoxsuprin 5 Mg Ml 2 Ml Amp , 1593 Inj Neostigmin 0 5 Mg Ml 1 Ml Amp , 1963 Inj Rocuronium 50 Mg 5 Ml , 2111 Inj Lorazepam 2 Mg Ml 2 Ml Amp , 2113 Inj Midazolam 1 Mgml 5 Ml , 1547 Inj Daltaparin 5000 Iu 0 2 Ml Antifactor , 4674 Inj Torsemide 10 Mg Ml 2 Ml Amp , 4261 Inj Vasopressin 20 Iu Ml 1 Ml Amp , Inj Insulin Aspart Pre Filled Pen Novarapid Flex Pen , 3532 Inj Insulin Aspart 100 U Ml 10 Ml Vial , 1119 Inj Aqueous Sol Of Haemocoagulase 1 Ml Botrophase , 1027 Inj Contrast Media Mri Gadolinium , 1106 Inj Contrast Non Ionic Monomer 370 Mg Ml Iopamidol 100 Ml Bottle , 1403 Inj Hyaluronidase 1500 Iu Powder 2 Ml Vial , 1715 Inj Phene Maleate 22 75 Mg Ml 2 Ml Amp , 3531 Inj Tocilizumab 400 Mg 20 Ml , 3530 Inj Tocilizumab 200 Mg 20 Ml , 2253 Dinoprostone 0 5mg Gel 1ut , Inj Cloxacilline 500 Mg , Inj Caffeine Citrate 20 Mg Ml 1 Ml Vial Capnea , Inj Sugammadex 100 Mg Ml 2 Ml Vial , Inj Epitrate 1 Ml , Inj Phenocaine Plus 1 Ml , Inj Chlorpromazine 25 Mg , Inj Esmolol 10 Ml , Inj Ramifentanil 2 Mg , Inj Levobupivacaine 0 5 Parsentage Isobaric 4 Ml Amp 20 Mg Neon , Amphotericin B 50mg Injection Powder Form , Indocyanine Green Usp Sterile Powder 25 Mg Lyophilized , 2564 Tigicycline 50mg Inj , Tigicycline 100 Mg Inj , Morphine 10 Mg , Paracetamol 650 Mg , Tramadol 50 Mg , Tapentadol 50 Mg , 4398 Etoricoxib 60mg Tablet , 4503 Celecoxib 200mg Capsule , 4400 Gabapentin 300 Mg Tablet , 4711 Pregabalin 75mg Capsule , Domperidone 10mg Paracetamol 325mg Tramadol 37.5mg , Inj Remdesivir 100mg , Syp Kesol Potssium Chloride Solution 200 Ml Bottle , Syp Cital Disodium Hydrogen Citrate 100 Ml , Deferiprone Kelfer 500 Mg Capsules , Deferasirox 250 Mg Tab , Deferasirox 500mg Tab , Hypersol 6 Eye Ointment Sodium Chloride , Levetiracetam Syp 100 Ml 100mg Ml , Griseofoulvin 250 , Injection Valthamet Bromide 8mg Ml Amp , Drop Bromfenac 0 09parsentage Wv Moxifloxacin 0 5parsentage Wv Eye Drop 5 Ml , Inj Voriconazole 200mg Vial , Cyclosporine Oral Solution Usp 100 Mg 50 Ml Bottle , Inj Etomidate 2 Mg Ml 10 Ml , Inj Sodium Tetradecyl Sulphate 60 Mg 2 Ml 2 Ml Amp , Inj Mitomycin 40mg , Pyridoxine Vitamin B6 40 Mg , Inj Ampicillin 1 Gm Sulbactam 0 5 Gm , Inj Ampicillin Cloxacillin 500 Mg , Inj Vitamin D3 6 Lac , Norethisterone 5mg Tablet , Mifepristone 200 Mg Tab , Nicotinamide 200mg Ml Folic Acid 15mg Ml Cyanocobalamin 500mcg Ml , Voriconazole 200mg Inj , Valethamate 8mg Inj , Danazol 200mg Capsule , Amphotericin B 100mg Liposome Injection , Drotaverine 40mg Injection , Clobazam 5mg Tab , Albumin 20parsentage 20gm 100 Ml 100 Ml , Sodium Tetradecyl Sulphate 30mg Ml 2 Ml Amp , Inj Retiplase Tpa 18 Mg , Voriconazole 30mg 1 Parsentage W V Eye Drop , Factor 9 500 Iu 10 Ml , 2494 Factor Viii Concentrate 250 Iu , Folic Acid 0 7mg Methylcobalamin 2500mcg Niacinamide 12mg Vitamin C 150mg , 2718 Tab Deferasirox 500mg , Clopidogrel 150 Mg , Inj Amoxycillin Clavalunic Acid 600 Mg , Lactic Acid Bacillus Sachet , Tab Nitrofurantoin 100 Mg , Prazolam 0 25mg , Co Enzyme Q 10 Vitamin , Potassium Chloride 1 Mg , Etizolam 0 25 Mg , Nitazoxanide 500 , Ibuprofen And Paracetamol , Sacubitril 24 Mg Valsartan 26 Mg , Rivaroxaba 10 Mg , Nitrendipine , Syp Cyclosporine 100mg Ml , Cap Thalidomide 100mg , Rituximab Injection , Tofacitinib 5 Mg , Tab Nicotinamide 250mg , Formoterol Budesonide Inhaler , Benzonatate , Disperzyme , Calcitriol Calcium Cit , Duloxetine Hcl 30 Mg Tab , Prazosin Xl 5mg , Mycophenolate Sodium , Alendronic Acid 35 Mg , Ranitidine 150mg , Acityl Salisalic ?? ????/bid Details 2 / 111 Acid 75 Mg , Rifaximine 400 Mg , Glutone Glutone C Tablet , Hydroxyurea 500mg , Ubiquinol Acetate 100 Mg , Transfer
