"नये भारत का नया Tender Portal"
Request a call back

Latest Tenders for thiobarbituric acid

Total 52 tenders found
#TBR: 35282363 Live

Education And Research Institutes

  • Jharkhand
  • Due On: 24 Sep, 2025 (2 Days Left)

Gem Bids For Financial, 2 Thiobarbituric Acid Hi Ar 1 3 5 Triphenyltetrazoliumformazan 2 3 5 Triphenyl Tetrazolium Chloride Adenosine5 Diphosphate Disodium Salt Aluminium Chloride Ammonium Chloride Ammonium Dihydrogenorthophosphate Ammonium Fluoride Ammoniummolybdate Tetrahydrate Ammonium Sulphate Ammoniumhydroxide Anthrone Hi Ar Acs Antimony Potassiumtartrate Barium Chloride Brilliant Green Brilliant Blue Bromocresol Green Bromothymol Blue Indicator Butylatedhydroxytoluene Bht Pure 99 Calcium Carbonate Calciumchloride Anhydrous Calcium Chloride Dihydrate Calciumcitrate Tetrahydrate Calcium Hydroxide Calciumphosphate Di Basic Anhydrous Calcium Phosphate Tri Basictcp 90 Calcium Sulphate Di Hydrate Carbol Fuchsinpractical Grade Carboxymethylcelluose Acicase Caseinacid Hydrolysate Casamino Acids Chromeazurol Schromazurol S Cas Darco G 60 Activated Charcoal Citricacid Anhydrous Cobaltous Chloride Hexahydrate Cobaltnitrate Hexahydrate Congo Red Practical Grade Coomassie Brilliant Blue G Copper Chloride Dihydrate Copper Ii Sulphate Pentahydrate Devarada S Alloy Dextrose Diacetyl Monoxime Diacetyl Fluorescein Sodium Diethyldithiocarbamate Trihydrate Diphenylamineindicator 3 5 Dinitrosalicylic Acid Di Potassium Hydrogenphosphate Anhydrous 2 4 Dinitrophenylhydrazinear Edtafree Acid Edta Disodium Salt Dihydrate Ferric Ammoniumcitrate Brown Ferric Ammonium Sulphate Dodecahydrate Ferric Nitrate Nonahydrate Ferrous Ammonium Sulphate Ferrous Sulphate Heptahydrate A R Fluorescein Ferroussulphate Heptahydrate Fe Metal Iron Powder Folic Acid Gum Acacia Hiimvic Biochemical Test Kit Hi Staphtmidentification Kit Hiassorted Biochemical Test Kit Hi25tmenterobacteriacea Identification Kit Hicarbo Kit D Bid Number Gem2025b6640725 Dated 03-09-2025 Bid Document1 110 1 1 Glucose Anhydrous, L Glutamic Acid Monosodium Saltmonohydrate Msg Extra Pure 99, L Glutamine, Glycinepure 99, Hepes Buffer Free Acid, Hydroxylaminehydrochloride, Hydrindantin, 8 Hydroxyquinoline 8quinolinol Extra Pure Ar Acs 99 5, Imidazole, Indole 3acetic Acid, Iodine, Lactose, Lithium Nitrate, Lithiumchloride, Mes Buffer, Mops Buffer Free Acid, Monocalcium Phosphate Monohydrate, Magnesium Carbonate, Magnesium Chloride Anhydrous, Manganese Ii Sulphateheptahydrate, Manganese Ii Chloride Tetrahydrate, Magnesium Chloride Hexahydrate, Magnesium Sulphateanhydrous, Magnesium Sulphate Heptahydrate, Magnesium Hydroxide, Maleic Acid, Dl Malic Acid Free Acid, D Mannitol Extra Pure Ar 99, Mercuric Chloride, Metaphosphoric Acid, L Methionine, Methyl Red, Nessler Sreagent, Nadph, Nickel Ii Chloride Hexahydrate, N 1naphthyl Ethylenediamine Dihydrochloride, Ninhydrin, Nitro Blue Tetrazolium Chloride Nbt, Oxalic Acid, Peroxoboric Acid H3bo4, Phenol Crystal, Phenyl Mercuricacetate, Picric Acid Extra Pure Ar 99 8, Pipes 1 4piperazinediethanesulfonic Acid, Polyethylene Glycolmw6000, Polyvinyl Pyrrolidone Pvp, Potassiumbicarbonate, Potassium Carbonate Anhydrous, Potassiumchloride, Potassium Dihydrogen Ortho Phosphate, Potassium Hydroxide Pellet, Potassium Hydrogen Phthalate, Potassium Iodate, Potassium Per Iodate, Potassiumpermanganate, Potassium Nitrate, Potassium Sulphate, Lproline, Riboflavin, Salicylic Acid, Selenium Powder, Silversulphate, Sodium Arsenate Dibasic Heptahydrate, Sodiumazide, Sodium Bicarbonate, Sodium Carbonate Anhydrous, Sodium Chloride, Sodium Citrate Trihydrate, Sodiumdithionite, Sodium Diethyldithiocarbamate Trihydrate, Disodium Hydrogen Phosphate Anhydrous, Sodium Hydroxidepellets, Sodium Molybdate Dihydrate A R, Sodium Nitrate, Sodium Nitrite, Sodium Nitroprusside Di Hydrate, Sodiumpotassium Tartrate Tetrahydrate, Sodium Sulphateanhydrous, Sodium Sulphite, Sodium Tartarate, Sulfanilamide, Sulphosalicylic Acid, Sucrose, Tartaric Acid, Thio Urea, Thiosemicarbazide, Thioglycollic Acid, Trishydroxymethyl Aminomethane Tham, Tris Hydrochloride, Titanium Dioxide, Trichloroacetic Acid, Tri Sodium Citratedihydrate, L Tryptophan, Tris Base, Urea, 2 Vinylpyridine, Zinc Chloride, Zinc Metal, Zinc Sulfate Heptahydrate, Acetic Acid Hplc, Glacial Acetic Acid, Acetone Hi Ar, Ammonium Solution 28 30, Chloroform Hi Ar, Dimethylsulphoxide Hi Lr, Clove Oil, Ethanol, Folin And Ciocalteu Sphenol Reagent, Ferroin Diphenylamine Indicator, Formaldehyde Sol 37 41, Formamide Liquid, Glycerol Hi Ar, Hydrochloric Acid 35 Pure, Hydrogen Peroxide, Iodinesolution, Isoamyl Alcohol, Kovacs Indole Reagent, Methanol, Methyl Cellosolveextrapure Ar 99 5, Mineral Oil, Nessler S Reagent For Ammonia, Nitric Acid 68 72 Pure, Npropanol, Paraffin Liquid Heavy Mineral Oil Heavyextrapure, Orthophosphoric Acid Abt 85, Orthophosphoricacid Abt 88, Phosphoric Acid, Conc Sulphuric Acid, Sodiumlactate 60 Solution Extra Pure, Sodium Hypochloritesolution, Toluene, Triton X 100, Triethanolamine Ar 98

8.71 Lacs
View Tender
#TBR: 35224794 Closed

Education And Research Institutes

  • West Bengal
  • Due On: 15 Sep, 2025 (0 Days Left)

Gem bids for Price, Hydrogen Peroxide, Nitroblue Tetrazolium Chloride Nbt, Potassium Cyanide, Ortho Phosphoric Acid, L Proline, Sodium Hydroxide, Coomassie Brilliant Blue G 250, Ethanol, Thiobarbituric Acid, 3 3 Diaminobenzidine, Ammoniumhydroxide, L Cysteine, Alpha Glutamate, Adenosine 5Triphosphate Disodium Salt, Tris Hydrochloride, Alphaketoglutaric Acid, L Glutamine, Beta Nicotinamide Adeninedinucleotide Disodium Salt, Sulfanilamide Extrapure Ar, N1 Naphthyl Ethylene Diamine Solution, Diethyl Dithiocarbamate, Potassium Sulphate

75.0 Thousand
View Tender
#TBR: 35204211 Closed

Education And Research Institutes

  • Uttaranchal
  • Due On: 11 Sep, 2025 (0 Days Left)

Gem bids for Non, Bid Number Gem2025b6595690 Dated 21-08-2025 Bid Document1 57 1 1 Dulbeccos Modified Eagle Medium Dmem W O Lglutamineglucose Phenol Red Sodium Pyruvate And Sodiumbicarbonate, Minimum Essential Medium Eagle Me Joklikmodification For Suspension Culture Wl Glutamine Wocalcium Chloride And Sodium Bicarbonate, Niacinamide, Pluronic F 68 Solution 10 100X, Ammonium Persulphateaps For Molecular Biology 99 Ammonium Peroxodisulphate, Nnnn Tetramethylethylenediamine Temed Extrapure Arexiplus Multi Compendial 99, Corning 96 Well Clear Flatbottom Polypropylene Not Treated Microplate 25 Per Bagwithout Lids Nonsterile, Cryovials Externally Threaded, Mini-Protean Spacer Plates With 1 0 Mm Integratedspacers, Mini Protean Short Plates, Formaldehyde Testkit Colorimetric, Formaldehyde Test Photometric, Formaldehyde Test Strips Colorimetric, Acetyl Acetone, Ammonium Acetate, Glacial Acetic Acid, Thioglycolatebroth, Sabouraud Dextrose Broth, 96 Well Clearpolystyrene Microplate, 1000Ul Micropipette Tips Barriertips Filter Tip, Pasteurs Pipette, 5 Ml Micro Centrifugetubes, Erlenmeyer Conical Flask, Petri Dish, Glass Cellspreader, Tips, Phosphate Buffered Saline Tablets, Sodiumbicarbonate, Sodium Carbonate, Sulphuric Acid Pure Hi Ar, Field Test Kits For Lons Ca2 Mg2 Na K F So42 Sio2 Ci Po42no3 Total Alkalinity Total Hardness Nco3 Co32 Tan No3 N, Sodium Hydroxide Pellets, Hydrogen Peroxide 30Solution, Boric Acid, Hydrochloric Acid, Sodiumhypochlorite, Alizarine Red S Ar, Alcian Blue 8Gxfor Microscopy, Sodium Thiosulphate, Starchsoluble, Potassium Iodide, Acetic Acid Glacia, Formaldehyde Solution 37 41, Iso Propyl Alcohol, Glycerol, Potassium Hydroxide Pellets, Chloroform, Sodium Sulphate, Trichloroaceticacid, Thiobarbituric Acid, Perchloric Acid, Methylred, Bromocresol Green Indicator Solution, Sodium Chloride, Ferrous Sulphate, Biosoft Tissue, Kimwipes, Cryo Tags, Tough Spots, Wrap Up Aluminiumfoil, Kimberly Clark Purple Nitrile Gloves, Histology Slidebox With Hinged Cover, 96 Well Elisa Plates, Adhesivetransparent Film Sheets, Wrappupalluminium Foils, Parafilm, Tough Tags, Tough Spots, Kimwipes, Conicaltubes, Wettask, Filter Paper, Ldpe Sampling Bottles, Hdpe Sampling Bottles, Pour Boat Weighing Boat, Solventresistant Pen

5.92 Lacs
View Tender
#TBR: 35107601 Closed

Education And Research Institutes

  • Andhra Pradesh
  • Due On: 02 Sep, 2025 (0 Days Left)

Gem Bids For Sample Bags Ldpe Non Autoclavable 100 Micron Thickness 9 133l , Sample Bags Ldpe Non Autoclavable 100 Micron Thickness 5 8 0.5l , Pasteur Pipette Ldpe 3 Ml Capacity , Sterile Sample Container Pp With Hdpe Closure 100 Ml Capacity , Formalin 1 Lt Bottel , Cynocobolime 250mg , Sodium Nitrate 50 Kg , Edta 500g , Sodium Silicate 1 Kg , Activated Charcoal 500 , Epinephrine , Dntb Ellmans Reagent , Reduced Glutathione Gsh , Glutathione Reductase Kit , Tbars Thiobarbituric Acid , Butylated Hydroxytoluene , Methanol 2.5 L , Microtipbox 2 200ul 96 Places Pk 10 , Microtipbox 200 1000ul 96 Places Pk 10 524059 , 3 Micro Tips Pp Autoclavable200 Ref 521014 , Micro Tips Pp Autoclavable1000 Ref 521016 , 5 Microtipspp 0.2 10 Pk 1000 52100 , 4 Micro Pestle Pp Autoclavable Pk 12 160020 3 , 8 Spinix Tm Vortex Shakerspinix Tm Mc 01 With Speed Control 3020 , Spare Cup Attachment , Spare One Hand Insert 3003 , 2 Spare Micro Tube Insert 3004 , Tissue Homogenizers Micaro Pestle , Thick High Strengthhigh Temp Resistantautoclave 8 X 12 550021 1.6 L Capacity , Autoclavable Biohazard Bags8x12 Pk 100 , Culture Tube Flat Bottom Clear With Pp Cap -15 Ml 9910007 , Tubes Funnel Test Tubes 15ml 6150007 , Glass Filter Funnel Plain Short Stem35mm 6140058 , Glass Filter Funnel Plain Short Stem 65mm 6140069 , Cylinders Grad. Class B 10 Ml 3022006 , Cylinders Grad. Class B 25 Ml 3022009 , Cylinders Grad. Class B 100ml 3022016 , Cylinders Grad. Class B 500 Ml 3022024 , Test Tubes With Rim15ml15x150 9800u05 , Tubes Test Culture Without Rim 25 Ml 9820u19 , Testubeswithrim27ml 18x 150 Mm 9800u06 , Tubes Culture Media Fbptfe 5ml , Tubes Culture Media Fbptfe 10ml 9910006 , Dish Culture Petri100 X 15sline 3165077 , Mueller Hinton Agar , Zobell Marine Agar , Mycological Agar , Potassium Permanganate , Bacillus Cereus Selective Agar Base , Luria Bertani Broth Miller , Tcbs Agar , Sobouraud Dextrose Agar , Bacillus Differential Agar , Bacillus Medium , Streptococcus Thermophilus Isolation Agar , Thiobacillus Broth , Vibrio Vulnificus Agar , Mrs Broth , Cysteine Hydrochloride , Oxycycline Hydrochloride , Chloramphenicol , Pencillin G Sodium Salt , Oxytetracycline , Homogenizer With Serrated Pestle , Pseudomonas Isolation Agar Base

6.50 Lacs
View Tender
#TBR: 34791920 Closed

Scientific Research/instruments

  • Delhi
  • Due On: 31 Jul, 2025 (0 Days Left)

Gem Bids For Chemicals, 2 Thiobarbituric Acid 500gm, Potassium Phosphatemonobasic 500gm, Heparin Sodium Salt 1gm, Tween 20500ml, Sodium Dodecyl Sulphate 1 Kg, Coomassie Brilliantblue G 250 25gm, Meta Phosphoric Acid 500gm, 2mercaptoethanol 1ml, Ethanol 500ml, Petroleum Ether 2.5l, Sulphuric Acid 500ml, Acetonitrile 2.5l, N N N Ntetramethyl Ethylenediamine Temed 500ml, Ammoniumpersulphate 500gm, Hydrochloric Acid 500ml, 2 7dichlorofluorescein Diacetate 100mg, Trichloroacetic Acid250gm

9.91 Lacs
View Tender
#TBR: 34781705 Closed

Education And Research Institutes

  • Andhra Pradesh
  • Due On: 28 Jul, 2025 (0 Days Left)

Gem Bids For 272025, Sample Bags, Ldpe Non Autoclavable, 100 Micron Thickness9 133l, Sample Bags, Ldpe Non Autoclavable, 100 Micronthickness 5 8 0.5l, Pasteur Pipette, Ldpe, 3 Ml Capacity, Sterile Sample Container, Pp With Hdpe Closure 100 Mlcapacity, Formalin 1 Lt Bottel, Cynocobolime 250mg, Sodium Nitrate 50 Kg, Edta 500g, Sodium Silicate 1 Kg, Activated Charcoal 500, Epinephrine, Dntb Ellmansreagent, Reduced Glutathione Gsh, Glutathionereductase, Tbars Thiobarbituric Acid, Butylatedhydroxytoluene

Ref. Document
View Tender
#TBR: 34755108 Closed

Education And Research Institutes

  • Andhra Pradesh
  • Due On: 23 Jul, 2025 (0 Days Left)

Gem Bids For 272025, Sample Bags, Ldpe Non Autoclavable, 100 Micron Thickness9 133l, Sample Bags, Ldpe Non Autoclavable, 100 Micronthickness 5 8 0.5l, Pasteur Pipette, Ldpe, 3 Ml Capacity, Sterile Sample Container, Pp With Hdpe Closure 100 Mlcapacity, Formalin 1 Lt Bottel, Cynocobolime 250mg, Sodium Nitrate 50 Kg, Edta 500g, Sodium Silicate 1 Kg, Activated Charcoal 500, Epinephrine, Dntb Ellmansreagent, Reduced Glutathione Gsh, Glutathionereductase, Tbars Thiobarbituric Acid, Butylatedhydroxytoluene

2.00 Lacs
View Tender
#TBR: 34605839 Closed

Scientific Research/instruments

  • Delhi
  • Due On: 25 Jun, 2025 (0 Days Left)

Gem Bids For Chemcials , Trichloroacetic Acid , 2 Thiobarbituric Acid , Potassium Phosphate Monobasic , Heparin Sodium Salt , Tween 20 , Hydrochloric Acid , Sodium Dodecyl Sulphate , Coomassie Brilliant Blue G 250 , Meta Phosphoric Acid , Mercaptoethanol , Ethanol , Petroleum Ether , Sulphuric Acid , Acetonitrile , N N N N Tetramethyl Ethylenediamine Temed , Ammonium Persulphate , 2 7 Dichlorofluorescein Diacetate

9.91 Lacs
View Tender
#TBR: 34278450 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 16 Apr, 2025 (0 Days Left)

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

Ref. Document
View Tender
#TBR: 34236184 Closed

Security Services

  • Delhi
  • Due On: 04 Apr, 2025 (0 Days Left)

Supply Of Mops Buffer 25g , Triton X 100 100ml , Beta 2 Mercaptoethanol 100ml , Integrin Beta1 Or Itg B1 A4 Antibody 200ug Per Ml , Dnase I 100mg , Rnase Zap 250ml , Acetone Emplura 500ml , Trolox 500mg , Isoflurane 250ml , Crotaline 1gm , Urethane 100gm , Protease Inhibitor Cocktail 100x 1ml , Carboxy Methyl Cellulose Sodium Salt 500gm , Acrylamide 1kg , Copper Sulphatehexahydrate 500gm , Exo Rneasy Midi Kit 50reactions , Molecular Grade Ethanol 500ml , Paraformaldehyde 500gm , Evans Blue 10gm , Depc Treated Water 500ml , Formamide 100ml , Temed 100ml , Nitrocellulose Membrane Roll , Skim Milk Powder 500gm , Dpbs,nocalcium,no Magnesium 500ml , Sodiumphosphate, Monobasic,monohydrate 500gm , Meta Phosphoric Acid 100gm , Cd63 Antibody 200ug Per Ml , Dtnb 5gm , Rna Later 100ml , Ripa Buffer 10x 100ml , Reverse Transcription Kit 50reactios , Lys C Endoproteinase,ms Grade 20ug , Ecl 2x250ml , Cd9 Antibody 200ug Per Ml , Cd31 Or Pecam 1 Antibody 100ug , Cd41 Antibody Or Integrin Alpha 2b Antibody 100ug Per Ml , Alpha Actinin 4 Antibody 200ug Per Ml , Calnexin Recombinant Rabbit Monoclonal Antibody 100ul , Endothelin 1 Monoclonal Antibody 100ul , Epcam Polyclonal Antibody 100ug , Rneasy Mini Kit 50reactions , Goat Anti Rat Igg H And L Secondary Antibody 1ml , Bca Protein Assay Kits 100 Reactions , Goatanti Rat Igg H And L Secondary Antibody,hrp 1ml , Goat Anti Human Igg Secondary Antibody, Hrp 1ml , Epas 1 Or Hif 2 Alpha Antibody 200ug Per Ml , Goat Anti Humanigg H And L Secondaryantibody 1mg , Collagenase D 100mg , Rat Sod Elisa Kit 96well , Rat Ace Elisa Kit 96well , Glutathione Peroxidase Assay Kit 480tests , Rna Blood Mini Kit 50reactions , Human Nox4 Nadph Oxidase 4 Elisa Kit 96well , Rat Et1 Elisa Kit 96well , Rat Xanthine Oxidase Elisa Kit 96well , Apob Antibody 200ug , Rat Renin Elisa Kit 96well , Anti Hsp 90 Antibody 100ug , Quercetin 10gm , Sample Buffer Laemmli 2xconcentrate Pack Of 10 Vials , Sequencing Grade Modified Trypsin 5 X20ug , Formicacid 98 To 100percent 50ml , Nadh, Disodium Salt 1gm , Ethanol 500ml , 2 Thiobarbituric Acid Analytical Reagent 99percent 100gm , Protein Dual Colour Standard 500ul , Hif1a Antibody 200ug Per Ml , Beta Tubulin Antibody 200ug Per Ml , Sybr Green Pcr Kit 200reactions

25.83 Lacs
View Tender
Download Document