Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G
Supply of ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol
Supply Of Acetic Acid Glacial, Acetone, Acetonitrile Hplc Grade, Alpha Dplus Glucose 99 Plus Percentage Anhydrous Ar, Ammonium Acetate Ar Grade, Ammonium Chloride Er Ar Grade, Ammonium Dihydrogen Orthophosphate Er, Ammonium Ferrous Sulphate Hexa Hydrate, Ammonium Hepta Molybdate Tetrahydrate, Ammonium Purpurate Murexide Ar Or Sq Gr, Arsenic Trioxide 99Percentage Ar Ar Grade, Barium Chloride Dihydrate Er Ar Grade, Benzene 99.5Percentage Ar Ar Grade, Bromo Cresol Green Indicator Ar Grade, Bromo Phenol Blue Indicator Ph 3.0 4.6, Bromo Thymol Blue Indicator Ar Grade, Calcium Carbonate Precipitated 99Percentage, Calcium Chloride Fused Sq Sq Grade, Chloroform Er Ar Grade, Chromotropic Acid Disodium Salt, Cupric Sulphate Pentahydrate Er Ar Grade, Dextrose Anhydrous Er Ar Grade, Di Sod Hydrogen O Phosphate Anhydrous, Edta Disodium Salt Dihydrate Ar Grade, Eriochrome Black T, Ethanol Ar, Ferric Chloride Hexahydrate 97Percentage, Formaldehyde Solution 37 41Percentage W Or V, Glycerol Sq Glycerine Ar Or Sq Grade, Hydrochloric Acid Er Ar Grade, Iso Propyl Alcohol Propan 2 Olar Grade, L Glutamic Acid 99Percentage, Liq.Ammonia Solution 0.91About 25Percentage Nh3, Manganese Ii Sulphate Monohydrate 99Percentage, Mercuric Chloride Ar Grade, Mercuric Sulphate Ar Grade, Methanol Dried Ar Grade, Methyl Orange Indicator Powder Ar Grade, Methyl Red Indicator Powder Ar Grade, Methyl Thymol Blue Ar Ar Grade, Methylene Blue Staining Powder Ar Grad, Metol 99Percentage Acs Ar Grade, N Hexane 99Percentage Ar Grade, Nitric Acid 69 72Percentage Er Ar Grade, Ortho Phosphoric Acid 88 93Percentage Er, O Toluidine 99.5Percentage Ar Grade, Oxalic Acid Er Ar Grade, Pararosaniline Chloride 88Percentage Ar Grade, Petroleum Spiripetroleum Ether40 Deg 60 Deg C, Phenol Detached Crystals 99.5Percentage Ar Grade, Phenolphthalein Indicator Powder, Potassium Chromate Ar Grade, Potassium Dichromate Ar Grade, Potassium Dihydrogen Ortho Phosphate Er, Potassium Hydroxide Pellets Er Ar Grade, Potassium Iodide Ar Grade, Potassium Metabisulphite 96Percentage Ar, Potassium Nitrate Er Ar Grade, Potassium Permanganate 99Percentage Ar Or Acs, Rochelle Salt, Silver Nitrate Ar Grade, Sodium Acetate Anhydrous Er, Sodium Acetate Trihydrate Er, Sodium Arsenite Ar Grade, Sodium Azide Ar Or Sq Grade, Sodium Bisulphite Ar Or Acs Ar Grade, Sodium Carbonate Anhydrous Ar Grade, Sodium Chloride Er Ar Grade, Sodium Dihydrogen O Phosphate Dihydrate, Sodium Hydrogen Carbonate Sodium Bicarb, Sodium Hydroxide Pellets Er Ar Grade, Sodium Hypochlorite Soln 4 6Percentagechlorine, Sodium Iodide Gpr Ar Grade, Sodium Metabisulphite Er Ar Grade, Sodium Metasilicate Nonahydrate, Sodium Nitrate 99Percentage Ar Or Acs Ar Grade, Sodium Nitroprusside Dihydrate Ar, Sodium Oxalate Ar Or Sq Grade, Sodium Sulphite Anhydrous Er, Sodium Thiosulphate Anhydrous 98Percentage Ar, Sulphamic Acid 99.5Percentage Ar Grade, Sulphanilamide Sulfanilamide 99Percentage, Thiosemicarbazide 98Percentage Ar Grade, Thymol Blue Indicator Powder Ar Grade, Tinii Chloride Anhydrous 98Percentage, Toluene Er Ar Grade, Tri Sodium Phosphate Anhydrous 99Percentage Ar, Universal Indicatorph 4 11 Ar Grade, 1 10 Phenanthroline Ar Or Higher, 1 Amino 2 Naphthol 4 Sulphonic Acid, 5 2 6 Kfrkf Reg Pyridine Free Solution, Biuret For Fertilizer Analysis 1 Gm P, Boric Acid Er Ar Or Higher Grade, Buffer Tablets Ph 4.0, Buffer Tablets Ph 7.0, Buffer Tablets Ph 9.2, Chlorotex Reagent, Citric Acid Anhydrous Ar 99.5Percentage., Diacetyl Monoxime 99Percentage, Ferroin Indicator Solution Ar Or Higher, Hydrogen Peroxide Solution 30Percentage W Or V, Indicator Papersph 1.0 To 14.0, Iodine Resublimed 99.8Percentage, Labolene Neutral Ph Ar Or Higher Grade, Magnesium Chloride Hexahydrate Er, Magnesium Sulphate Heptahydrate 99.5Percentage Ar, Mercuric Iodide Red Ar Or Higher Grade, Methanol For Hplc Ar Or Higher Grade, Neda Ar Or Higher Grade, Nessler S Solution, P Dimethyl Amino Benzaldehyde, Potassium Bromate 99.8Percentage, Potassium Hydrogen Phthalate, Potassium Iodate, Salicylic Acid 99.5Percentage, Silver Sulphate, Sodium Dihydrogen O Phosphate Anhydrous, Sodium Fluoride Er, Sodium Nitrite Er, Sodium Sulphate Anhydrous, Sodium Thiosulphate Pentahydrate Er, Starch Soluble Er Ar Or Higher Grade, Water For Hplc Ar Or Higher Grade, Zinc Acetate Dihydrate 99.5Percentage, N N Diethyl P Phenylenediamine Sulfate, Potassium Hydrogen Phosphate, Potassium Cyanide Ar Or Higher, Hydroxylamine Hydrochloride Ar Or Higher, Copperii Sulfaten Anhydrous Powder, Activated Charcoal Phospherous Free Ar, Potassium Persulphate Er Ar Grade, Ammonium Metavanadate Ar, Ammonium Oxalate Monohydrate 99.5Percentage Ar Or Ac, Di Ammonium Hydrogen Orthophosphate 98 Percentage, Zinc Metal 99.5 Percentage Granulated Cas 744, Bromine Water Cas 7726 95 6, Tri Sodium Citrate Cas 68 04 2, Ammonium Bicarbonate Ar Or Higher Gra, Tri Sodium Orthophosphate Cas 10101 89, Tashiros Indicator Cas 67 56 1, Calcium Acetate Cas 62 54 4, Trisodium Phosphate Cas 7601 54 9, Manganese Chloride Tetrahydrate 99Percentage Cas, Sodium Bromide Cas 7647 15 6, Semicarbazide Hydrochloride 99Percentage Cas 56, Dithizone Cas 60 10 6, Curcumin Reagent Ar Or Higher Grade, Glycine Ar Or Higher Grade Cas No., Wijs Solution Ar Or Higher Grade Ca, Rodine 115 Or Rodine 95 Acid Inhibitor 9, N N Dimethyl P Phenylenediamine Sulfate, Thymolphthalein Indicator Cas 125 20 2, Barium Hydroxide Ar Grade Cas 17194 00 2
Supply of V - Belts - Endless V - Belt for Industrial Purposes as per IS 2494, V - Belts - Endless Narrow V - Belts for Industrial use as per IS 14261, Antimicrobial Hand Wash (V2), Jersey Mens Woollen 'V' Neck (Defence), Line Interactive UPS with AVR (V2), Ammonium Metavanadate, XLPE Cable for Working Voltages up to and Including 1.1 KV as per IS 7098 (Part 1), uniform jersey woolen ribbed v neck dgsd specification, Diethyl Phenyl Acetamide 50% (DEPA 50%) - Defence, Diethyl Phenyl Acetamide 20 % (Depa 20 %) (Defence)
Supply of V - Belts - Endless V - Belt for Industrial Purposes as per IS 2494, V - Belts - Endless Narrow V - Belts for Industrial use as per IS 14261, Jersey Mens Woollen 'V' Neck (Defence), Insulation Tester, Ammonium Metavanadate, uniform jersey woolen ribbed v neck dgsd specification, Small Angle Grinders, Diethyl Phenyl Acetamide 50% (DEPA 50%) - Defence, Diethyl Phenyl Acetamide 20 % (Depa 20 %) (Defence), Wooden block
Supply Of 8525-16R22b41pnh - Cleaning Duster V2, Urethral Catheter, Desktop Computers, Books, Executive Table V2, Aortic Cannula V2, Solar Cells, Modular Electrical Switches And Accessories, Thoracic Drainage Catheter V2, Water Baths, 8525-16R10b6snh - Desktop Computers, Books, Cleaning Duster V2, Modular Electrical Switches And Accessories, Executive Table V2, Water Baths, Steel Bookcases As Per Is 7761, Electrical Box Extension V2, Online Ups V2, Waste Containers And Accessories - Domestic V2, 8525-16R22b55snh - Cleaning Duster V2, Books, Desktop Computers, Hexagonal Head Bolts, Screws And Nuts Of Product Grades A And B As Per Is 1364, Executive Table V2, Automotive Vehicles - Pneumatic Tyres For Passenger Car Vehicles - Diagonal And Radial Ply As Per Is 15633, Modular Electrical Switches And Accessories, Water Baths, Classroom Chairs, Portable Fire Extinguishers V2 As Per Is 15683:2018, 852-01R12 - Executive Table V2, Xlpe Cable For Working Voltages Up To And Including 1.1 Kv As Per Is 7098 Part 1, Hf Rfid Integrated Reader, Books, Cleaning Duster V2, Ultrasonic Cleaners, Stationary Valve Regulated Lead Acid Batteries As Per Is 15549, Helmet Combat Fiberglass, Steel Clothes Lockers Version 2 As Per Is 3314, Garam Masala As Per Is 13545, Sn201f-08-V - V - Belts - Endless V - Belt For Industrial Purposes As Per Is 2494, Rubber Gloves For Electrical Purposes As Per Is 4770, V-Belts - Endless V-Belt For Industrial Purposes - General Purpose-Is:2494, Vascular Grafts - Synthetic, V - Belts - Endless Narrow V - Belts For Industrial Use As Per Is 14261, Squeegee Washer Wiper Mopper V2, Jersey Mens Woollen V Neck Defence, Locking Compression Plates V2, Ammonium Metavanadate, Insulation Tester
Supply of V - Belts - Endless V - Belt for Industrial Purposes as per IS 2494, Sofas (V2), V - Belts - Endless Narrow V - Belts for Industrial use as per IS 14261, Alcohol Based Hand Sanitizer, Jersey Mens Woollen 'V' Neck (Defence), File Folder Cover (V2), RELAY FRAME ASSY.,MCC FRAME ASSY., D.P.LATCH FRAME ASSY (203BS43) (BHEL), Antimicrobial Hand Wash (V2), Ammonium Metavanadate, Rubber Gloves for Electrical Purposes as per IS 4770
Supply Of Chemicals - Chloroform, Sodium Polytungstate, Sulphuric Acid, Orthophosphoric Acid, Nitric Acid, Potassium Sulphate, Potassium Dichromate, Ferrousammoniumsulphate, Ferrion Indicator, Hydrochloric Acid, Phenolpthalein, Potasium Chloride, Magnesiumoxidepowder, Devardasalloy, Sulphamic Acid, Methyl Red Indiactor, Sodium Bicarbonate, Charcoal Activated, Ammonium Molybdate Tetrahydrate, L Ascorbic Acid, Selenium Metal Powde, Boric Acid, Salicylic Acid, 135Triphenyltetrazolium Formazan, Ethyl Alcohol, Potassium Permanganate, Sodium Carbonate, Methyl Red, Bromocresol Green, Ammonium Acetate, Ammonium Metavanadate, Ammonium Molbdate, Ammonium Oxalate Monohydrate, Acid Fuchsin, Acetone, Anisaldehyde, Acetic Acid, Agarosei Mbgrade, Anthrone Reagent, Fuchsin Basic, Borax Decahydrate, Bromocresol G Indicator, Benzoic Acid, Barium Hydroxide, Butylated Hydroxytoluene, Calcium Chloride Fused, Ctab, Citric Acid, Calcium Carbonate, Capsules Stails Kit, Copperiii Sulphate, Chromium Iii Oxide, Cupric Sulphate Pentahydrate, Cetyltrimethyl Ammonium Bromide, Carboxymethyl Cellulose Sodium, Casein Techanical, Casein Vitamin Free, Cellulose Powdered, Choline Chloride, Dimethyl Sulphoxide, Silica Gel Powder, Silica Gel Beads, Acetocarmine, Sucrose, Fehling Solution A, Fehlings Solution B, Methylene Blue Aqu Staining Sol, Potassium Ferrocyanide Purified 99, Potassium Iodate Pure 99, Acetic Acid For Hplc, Sodium Thiosulphate, Starch Hydrolysed For Biochemistry, Starch Potato Insoluble, Starch Soluble Potato Ar, Hydrochloric Acid 10N Aq Solution, Hydrochloric Acid 1N Aqsolution, Meta Phosphoric Acid, 26Dichlorophenol Indophenol Sodium Salt, 22Diphenyl 1 Picrylhydrazyl, Trolox 90, Neocuproine, 2 4 6 Tris2pyridyl S Triazine, Tris Buffer, Tris Hydrochloride, Sodium Chloride, 235Triphenyltetrazolium Chloride, Ammonium Chloride, Diethyl Ether, Hydrogen Peroxide Solution 30, Acetonitrile, Benzene Pure, Ethyl Acetate Pure, Formaldehyde 37 41 Solution, Glycerol Anhydrous, Toluene Pure, Perchloric Acid 70, Agarose Mb Grade, Lmethionine Extrapure, Paclobutrazol Pure, Indole 3 Butyric Acid, Potassium Iodide, Potassium Ferrocyanide Purified, Rna Grade Nuclease Free Water, Phenol Chloroformisoamyl Alcohol, Trypsin Standard Trysin Edta Solution, N A Benzoyl Dl Arginine 4 Nhc, 35 Dinitrosalicylic Acid, A Amylase Ex Malt, Methanol Hplc Spectroscopy, Folin Ciocalteus Phenol, Gallic Acid, Chlorogenic Acid, Sodium Nitrate, Quercetin Dihydrate Extrapure, Kuromanin Chloride, Hesperidine, Catechin Hydrate, Vanillin Ar, Ammonium Ferric Sulphate, Sodium Bisulphite, Sodium Phosphate, Sodium Hydroxide, Phenolphthalein Indiactor Sol, Silver Nitrate, Silver Thiosulphate, Lead Ii Acetate, Potassium Oxalate Monohydrate, 2Thiobarbituric Acid Tba, Epibrassinolide, Ammonium Dihydrogen, Aluminium Chloride, Bovine Serum Albumin, Calcium Chloride Dihydrate, Calcium Nitrate Tetrahydrate, Calcium Oxide Powder Pure, Carbinol, Chitosan Oligosaccharide, Dichloromethane, Ethylene Glycol, Fehedta N2hydroxyethyl Ethylenediaminetriacetic Acid, Glycine Betaine, Isopropanol, Kinetin Solution, Magnesium Nitrate Hexahydrate, Magnesium Sulphate Heptahydrate, Maganese Ii Chloride Tertrahydrate, Methanol Gradient Grade, Ninhydrin, Nitro Blue Tetrazolium Chloride, Potassium Chloride, Potassium Hydroxide, Potassium Phosphate Monobasic, Pyroxasulfone, Sodium Molybdate Dihydrate, Sulphanilamide, Tembotrione, Titanium Dioxide, Zinc Sulphate, Diluent For Nuceleic Acid Extraction, 5Bromochloro3indolyl, Methanol Mb Grade, Tris Saturated Phenol Ph 8, 10 Efficiency Taq Buffer, Pcr Grade Extrapure Mgcl, G9 Taq Dna Polymerase 10 X Buffer With Mgcl, Tris Buffer Ar Acs For Mb 999, Pcr Master Mix, Diethyl Pyrocarbonate Depc, Potassium Nitrate, 1Naphthylphosphoric Acid Disodium Salt Hydrate, Fast Blue B Salt, Ammonium Fluriode, Pnitrophenylphosphate Disodium Salt Hexahydrate, Dithiothreitol, Anza 5 Bamhi, Iptg Dioxane Free, Ethanol 99 Ar Grade, Sodium Hydroxide Pellets, Rat Serum, Gibberellic Acid Ga3 90
Purchase Of Chemicals - Sulfuric Acid About Percent, Ortho-Phosphoric Acid Min 85 Perrcent Emplura -500Ml, Ammonium Iron Sulfate Hexahydrate Emplura-500Gm, Boricacid Powder 99.5 Percent Extrapure - 500Gm, Sodium Hydroxide Flakes Emplura -1Kg, Methyl Red Indicator Ar -25Gm, Bromocresol Green Indicator Dye Content 95 Percent - 5Gm, Diluent For Dna Extraction For Molecular Biology - 500Ml, Nitric Acid About 69 Percent Emplura-500Ml, Charcoal Activated Pharma Grade-500G, Azomethineh Monosodium Salthydrate 95 Percent Ar 500G, Sodium Hydrogen Carbonate 99.5 Percent Extra Pure - 500G, Hydrochloric Acid About 35 Percent Emplura -500Ml, Ammoniumfluoride 95Percent Extra Pure -500G, Ammonium Molybdate Tetrahydrate 98 Percent Extra Pure -100G, Ammonium Metavanadate 98 Percent Extra Pure-100G, Antimony Potassiumtartrate Trihydrate 98.5 Percent Extra Pure-500G, L-Ascorbic Acid 99Percent Extra Pure -100G, Potassium Dihydrogen Phosphate Emplura -500G, Ammoniu Acetate Emplura -500G, Acetic Acid Glacial 99.5 Percent Extra Pure -500Ml, Diethylene Triamine Penta Acetic Acid 99 Percent For Synthesis - Dtpa - 500 G, Triethanolamine 98 Percent Extra Pure -500Ml, Calcium Chloride Dihydrate 98 Percent Extra Pure-500G, N-Hexane 99Percent For Synthesis -250 Ml, Perchloric Acid 70 Percent Ar-Acs - 500Ml, Potassium Sulphate 98.5 Percent Extra Pure - 500G, Ethylenediamin E Tetraacetic Acid Disodium Salt 99 Percent Extra Pure -Edta Disodium Salt -500G, Phenolphthalein Indicator -100G, Methanol 99.5Percent Extra Pure-250 Ml, Sodium Chloride Emplura - 500G, Potassium Chromate 99 Percent Extra Pure-500G, Folin And Ciocalteu S Phenol Reagent-100Ml, Sodium Nitrite 97 Percent Extra Pure-500G, Acetate Buffer, Ph5.6 5X100ml, 1, 1-Diphenyl-2- Picryl Hydrazine -1G, Sodium Carbonate Anhydrous 99.5 Percent Extra Pure -500G, Potassiumsodium Tartrate Tetrahydrate 98 Percent Extra Pure -500Gm, Sodium Sulphate Anhydrous 99 Percent Extra Pure-500 Gm, Cupric Sulphate Pentahydrate 98.5 Percent Extra Pure - Copper Sulphate Pentahydrate-500Gm, Oxalic Acid 99 Percent Extra Pure500gm, 2, 6-Dichlorophenol Indophenol Sodium Salt 98 Percent Ar-Acs-5Gm, Sodium Tungstate Dihydrate 98 Percent Extra Pure-100G, Phosphomol Ybdic Acidhydrate Ar-Acs 100Gm, Sodium Hypochlorite Solution Approximately 4 Percent Available Chlorine Emplura-1Lt, Pectin Extra Pure-500Gm, Calcium Nitrate Tetrahydrate98 Percent Extra Pure-500Gm, Polyethylene Glycol 4000 For Synthesis-500Gm, Isopropylalcohol 99 Percent For Synthesis-500Ml, Acetone 99 Percent Extra Pure-500Ml
Supply Of Laboratory Glassware And Chemicals - Beaker 50 Ml, Beaker 250 Ml, Beaker 500 Ml, Beaker 1000 Ml, Glass Cylinder 1000 Ml, Pipette 20 Ml, Pipette Controller, Ai Polypropylene Wash Bottle 500Ml, Conical Flask 250 Ml Flasks Erlenmeyer Conical Narrow Mouth With Graduation, Glass Stirring Rods, Whatman Filter Paper 4, Whatman Filter Paper 5, Dispensing Cup 6 Ml, Measuring Cylinder 250 Ml, Screw Type Plastic Container 25 Ml, G Pet Round Container 50 Ml, Microcover Slip, Glass Slide, Petri Dish 100Mm By 17Mm, Petri Dish 80Mm By 15Mm, U Shape Horse Shoe Bar Magnet High Power 3 Inches, China Bowl 750Ml, China Bowl 1 Litre, China Bowl 50 Ml, Separating Funnel With Glass Stop Cock, Microscope Slide Box, Glass Rod 1 Cm Thickness 20 Cm Length, 800 Ml Capacity Wide Porcelain Bowl 15 Cm Top Dia, Porcelain Crucible 20 Ml Capacity Without Lid, 35 Plus Or Minus Mm Top Dia, Height 30 Plus Or Minus 5Mm, Teflon Beaker 50Ml Without Lid, Automatic Pipette 0 To 5 Ml Variable Volume, Automatic Pipette 0 To 10 Ml Variable Volume, Test Tube Stand Plastic For 30 Ml Capacity Glass Tube Each 10 Series Upto 4 Line With 25 Plus Or Minus 2Mm Dia Hole, 200 Mesh Sieve In Body Brass Metal Nylon Mesh Top Dia 20Cm, Safety Nitrile Gloves, Safety Mask, Safety Goggles, Safety Rubber Gloves 30 Cm Length, Tissue Paper Rolls Soft Big Size 10Cm Breadth 40 Mtr Length 160 Gm Weight All Min, Whatman 1 Filter Paper 110Mm Dia One Box 100 Nos, Point 45 Micron Millipore Filter Paper Dia 47Mm 100N, Plastic Tray 50 Cm L 30 Cm B X 6 Cm Height, Asbestos Gloves 45 Cm Length, 1 Inch Transparent Tape Length 40Mts Min Wt 45Gms, 2 Inch Transparent Tape Length 40Mts Min Wt 135 Gms, Two Inch Brown Tape Length 40Mts Min Wt 140 Gms, Tongs For Crucible 8 Inch Stainless Steel, Tongs For Crucible 18 Inch Stainless Steel For Muffle Furnace, Tongs For Graphite Crucible 5 Feet Stainless Steel For Fire Assay Furnace, Silicon Rubber Bulb 10 Ml Capacity, Nickel Spatula, Glass Burette 50 Ml A Class, Glass Graduated Pipette 10 Ml A Class, Ammonia Solution 2500Ml, Acetone Ar 2500Ml, Hydrochloric Acid 2500Ml, Bromoform Special 250Ml, Hydrogen Peroxide 500Ml, Hydrofluoric Acid 48 Percent Ar 500Ml, Boric Acid Crystal Ar 5Kg, Suprapure Nitric Acid 70 Percent Ar 1 Litre, Calcium Carbonate Ar Or Acs Grade 250Gm, Ferrous Ammonium Ii Sulphate Ar 500Gm, Ammonium Metavanadate Ar 100Gm, Barium Diphenylamine Sulphonate Indicator 25Gm