"नये भारत का नया Tender Portal"
Request a call back

Latest Tenders for ammonium metavanadate

Total 39 tenders found
#TBR: 35766655 Closed

Steel And Iron Product

  • Andhra Pradesh
  • Due On: 22 Nov, 2025 (0 Days Left)

Gem Bids For Penicillin V, Xlpe Cable For Working Voltages Up To And Including 1.1 Kv As Per Is 7098 (part 1), Shuttlecocks (v2) Conforming To Is 415, Disconnectors (isolators) For Working Voltage Up To And Including 1 Kv, V - Belts - Endless V - Belt For Industrial Purposes As Per Is 2494, Water Baths, V - Belts - Endless Narrow V - Belts For Industrial Use As Per Is 14261, Jersey Mens Woollen 'v' Neck (defence), Laminar Air Flow Cabinets Or Stations, Ammonium Metavanadate

Ref. Document
View Tender
#TBR: 35356246 Closed

Scientific Research/instruments

  • Chhattisgarh
  • Due On: 03 Oct, 2025 (0 Days Left)

Gem Bids For Chemical, Bid Number Gem2025b6613203 Dated 11-09-2025 Bid Document1 57 1 1 Sodium Hydroxide - 500gm, Acetic Acid - 500ml, Bleachingpowder - 500gm, Sodium Thiosulphate - 500gm, Potassiumiodide -500gm, Ethylene Diamine Tetra Acetic Acid Disodiumsalt -500gm, Calcium Sulphate -500gm, Magnesiumsulphate - 500gm, Ammonium Chloride - 500gm, Hydrochloric Acid - 2.5ltr, Sulfuric Acid - 2.5ltr, Burettenosal Pipe - 200pcs, Burette Pinch Clip - 200pcs, Sodiumsulphate - 500ml, Sodium Carbonate - 500gm, Sodiumbicarbonate - 500gm, Conical Flask, Ordinary - 250ml, Ethanol - 2.5ltr, Litmus Paper, China Dish, Measuringcylinder - 10ml, Tissue Paper Roll, Butter Paper, Spatula 6inch - Steel, Funnel Glass 75mm, Funnel Glass 100mm, Glass Rod, Filter Paper - What Man 42, Test Tube Brush, Chromatography Paper, N-hexane - 2.5ltr, Lithium Nitrate500gm, Glycerol - 500ml, Citric Acid - 500ml, Sodiumcitrate - 500ml, Sodium Dihydrogen Phosphate - 500gm, Dipotassium Hydrogen Phosphate - 500gm, Lead Oxide -500gm, Molish Reagent - 500gm, Benzene - 500ml, Cobaltii Chlordide - 500gm, Potassium Sulphate - 500gm, Ferrousammonium Sulphate - 500gm, Isopropyl Alcohol - 500ml, Formalin - 500ml, Glycine - 500ml, Pyridine - 500ml, Magnesium Carbonate - 500gm, Phosphoric Acid - 500ml, Sodium Phosphate - 500gm, Amyl Alcohol - 500ml, Sodiumpyrophosphate - 500gm, Mercuric Chloride - 250gm, Hydrochloric Acid - 500ml, Acetone - 500ml, Diethyl Ether -500ml, Benzophenone 500ml, Magnesium Pieces - 500gm, Sulfanilic Acid - 500ml, N N-dimethyl Aniline - 500ml, Dimethyl Sulphoxide - 500gm, N-butyl Nitrite - 500ml, Anthracene - 500gm, Maleic Anhydride - 500ml, Xylene -500ml, Dimethyl Formamide - 500ml, Bromobenzene -500ml, Benzaldehyde - 500gm, Acetanilide - 500gm, Sodium Bisulphate - 500gm, Rectified Spirit - 500ml, Cyclohexanol - 500ml, Ammonium Metavanadate - 500gm, Ammonia Solution - 500ml, Ethanol - 500ml, Methanol -500ml, Test Tube 25x150 Mm, Test Tube Stand For 55mltube, Acetone Commercial Grade, Wash Brush, Agatemortal Pestle 4 Inch Id, Dispo. Face Mask, Methyl Acetate500ml, Ammonium Sulphate 500ml, Nitric Acid 500ml, Barium Sulphate - 500gm, Saturated Iodine Solution -500ml, Sodium Acetate Anhydrous - 500gm, Rubber Tubes, Conical Flask 50ml, Conical Flask 100ml, Conical Flask -500ml, Beaker - 50ml, Beaker - 100ml, Beaker - 250ml, Beaker - 500ml, Beaker - 1000ml, Filtration Flask - 500ml, Separating Funnel - 250ml, Cerium Nitrate - 500gm

1.63 Lacs
View Tender
#TBR: 35330476 Closed

Education And Research Institutes

  • Jharkhand
  • Due On: 01 Oct, 2025 (0 Days Left)

Gem Bids For Ammonium Metavanadate Extrapure Ar 99 100g, Ammonium Molybdate 250g, Ammonium Oxalatemonohydrate Extrapure 98 500g, Acid Fuchsin 25 Gm, Acetone Hi Ar 99 5 2 5ltr, Acetone Lr 2 5 Litre, Anisaldehyde Hi Ar 250ml, Acetic Acid 500 Ml, Agarose Imolecular Biology Grade 100g, Anthrone Reagent 25g, Basic Fuchsin 25 Gm, Boric Acid Extrapure Ar 99 5 500g, Bromocresol Green 5 G, Bromocresol Green Indicator 125ml, Boric Acid Powder 500g, Boric Acid 1kg, Benzoic Acid500g, Barium Hydroxide 500g, Butylated Hydroxytoluene500g, Citic Acid Hi Ar 99 7 500 G, Calcium Carbonate Hi Ar99 500g, Capsule Stains Kit, Copper Ii Sulphate 500 Mg, Copper Sulphate 500g, Chromium Iii Oxide 5 G, Chloroform500ml, Chloroform Contains 100 200 Ppm 500ml, Cupric Sulphate Pentahydrate 500 G, Cetyltrimethylammonium Bromide 100 G, Carboxymethylcellulose Sodium Salt Medium Viscosity Cmc100g, Casein Technical 500g, Casein Vitamin Free Revisedas M Protein Vitamin Free 500g, Cellulose Powdered 500g, Choline Chloride 100g, 1 Chloro 2 4 Dinitrobenzene 500g, Decalin Pure 98 500 Ml, Decalin 500ml, D Fructose 100gm, Diethyl Ether Hi Ar 99 500 Ml, Diethyl Ether 2 5 L, Dextrose Anhydrous Hi Ar 500 G, Dpph 2 2 Diphenyl 1picrylhydrazyl 1gm, Di Sodium Hydrogen Phosphateanhydrous Hi Ar 500 Gm, Di Sodium Tetraboratedecahydrate 500g, 3 6 Diacetyl Fluoresein 5gm, Diosgenin, Di Acetyl Monoxime Hi Ar 100gm, Dextrin White 500g, Dipotassium Hydrogen Phosphate 500g, Disodiumorthoarsenate 100g, 5 5 Dithiobis 2 Nitrobenzoic Acid 5g, Depc Treated Water 500ml Each 100ml, Dna Free Dnaremoval Kit 1000 Units, Epinephrine 5gm, Edta Disodiumsalt Dihydrate Pure 99 Hi Ar 500g, Eosin 2 W V 500 Ml, Eosin Blue Disodium Salt Practical Grade 25gm, Ethylenediamine Tetra Acetate Hi Ar 500 G, Edta Ethylene Diaminetetra Acetate 500g, Ethyl Acetate Hi Ar 99 5 500 Ml, Ethylene Glycol Hi Ar 500 Ml, Eosin Methylene Blue 25gm, Ethyl Cellulose 500 Ml, Emb Agar, Ferric Chloride Hi Ar 98500 Gm, Ferric Chloride Anhydrous Hi Ar, Ferrousammonium Sulphate Hexahydrate 500g, Formaldehyde500ml, Folic Acid 5g, Filter Paper 100s, Filter Paper100c, Glycerol Hi Ar 99 2 5 L

4.45 Lacs
View Tender
#TBR: 35323986 Closed

Power Plant

  • Andhra Pradesh
  • Due On: 01 Oct, 2025 (0 Days Left)

Gem Bids For Non Return Valve, Idler And Idler Sets For Belt Conveyor (v2) Conforming To Is 8598, Reusable Patient Return Electrode (v2), Xlpe Cable For Working Voltages Up To And Including 1.1 Kv As Per Is 7098 (part 1), V - Belts - Endless V - Belt For Industrial Purposes As Per Is 2494, V - Belts - Endless Narrow V - Belts For Industrial Use As Per Is 14261, Jersey Mens Woollen 'v' Neck (defence), Solenoid Valve With Spring Return In/exhaust, Ammonium Metavanadate, Diethyl Phenyl Acetamide 50% (depa 50%) - Defence

Ref. Document
View Tender
#TBR: 35202733 Closed

Education And Research Institutes

  • Orissa
  • Due On: 12 Sep, 2025 (0 Days Left)

Gem Bids For Chemical, 4 Aminoantipyrine Ampyrone, Ethyl Alcohol, Acetic Acidch3cooh, Acetone, Ammonia Solution Ammoniumhydroxide Concentrated, Ammonium Chloride, Ammoniumferrous Sulphate, Ammonium Metavanadate, Ammoniummolybdate Tetrahydrate, Barium Chloride, Boric Acid, Bromocresol Green Bcg, Calcium Chloride Fused, Carmine, Chloroform, Cobalt Ii Chloride Hexahydrate, Concentratednitric Acid, Copper Ii Sulfate, Curcumin Turmeric Yellow, Dipotassium Hydrogen Ortho Phosphate, Di Sodium Hydrogenphosphate, Disodium Salt Edta, Edta Magnesiumdisodium Complex Edta Mg, Eriochrome Black T, Ethyleneglycol, Ferric Chloride Anhydrous, Ferric Chloridehexahydrate, Ferroin Solution, Formaldehyde Solution, Hydrochloric Acid, Hydroxylamine Hydrochloride, Iodineresublimed, L-glutamic Acid, Magnesium Chloridehexahydrate Extrapure, Magnesium Sulphate Heptahydrate, Mercuric Chloride, Mercuric Sulphate, Methanol, Methylorange, Methyl Red, Murexide Ammonium Purpurate, N 1naphthyl Ethylenediamine Dihydrochloride Neda, N Ndiethyl P Phenylenediamine Sulphate Salt, N Hexane, Orthophosphoric Acid, Phenol, Phenolphthalein Indicator 1percent Soln In Ethanol, Potassium Chloride, Potassiumchromate, Potassium Dichromate, Potassium Dihydrogenphosphate, Potassium Ferricyanide, Potassium Hydrogenpthalate, Potassium Iodate, Potassium Iodide, Potassiumnitrate, Potassium Sulphate, Silica Gel, Silica Gel Blue, Silver Nitrate, Silver Sulphate, Sodium Acetate Anhydrous, Sodium Acetate Trihydrate, Sodium Arsenite, Sodium Azide, Sodium Borohydride Powder, Sodium Carbonate, Sodiumchloride, Sodium Hydroxide Pellets, Sodium Nitroprusside, Sodium Sulphate Anhydrous, Sodium Thiosulphatepentahydrate, Spadns, Starch Soluble, Sulphamic Acid, Sulphanilamide, Sulphuric Acid  /bid Number: Gem/2025/b/6519051* /dated: 22-08-2025  & & / Bid Document1 / 60

3.11 Lacs
View Tender
#TBR: 34278450 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 16 Apr, 2025 (0 Days Left)

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

Ref. Document
View Tender
#TBR: 34129111 Closed

Education And Research Institutes

  • Madhya Pradesh
  • Due On: 24 Mar, 2025 (0 Days Left)

Supply of ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

6.00 Lacs
View Tender
#TBR: 33768071 Closed

Chemicals

  • Uttar Pradesh
  • Due On: 22 Jan, 2025 (0 Days Left)

Supply Of Acetic Acid Glacial, Acetone, Acetonitrile Hplc Grade, Alpha Dplus Glucose 99 Plus Percentage Anhydrous Ar, Ammonium Acetate Ar Grade, Ammonium Chloride Er Ar Grade, Ammonium Dihydrogen Orthophosphate Er, Ammonium Ferrous Sulphate Hexa Hydrate, Ammonium Hepta Molybdate Tetrahydrate, Ammonium Purpurate Murexide Ar Or Sq Gr, Arsenic Trioxide 99Percentage Ar Ar Grade, Barium Chloride Dihydrate Er Ar Grade, Benzene 99.5Percentage Ar Ar Grade, Bromo Cresol Green Indicator Ar Grade, Bromo Phenol Blue Indicator Ph 3.0 4.6, Bromo Thymol Blue Indicator Ar Grade, Calcium Carbonate Precipitated 99Percentage, Calcium Chloride Fused Sq Sq Grade, Chloroform Er Ar Grade, Chromotropic Acid Disodium Salt, Cupric Sulphate Pentahydrate Er Ar Grade, Dextrose Anhydrous Er Ar Grade, Di Sod Hydrogen O Phosphate Anhydrous, Edta Disodium Salt Dihydrate Ar Grade, Eriochrome Black T, Ethanol Ar, Ferric Chloride Hexahydrate 97Percentage, Formaldehyde Solution 37 41Percentage W Or V, Glycerol Sq Glycerine Ar Or Sq Grade, Hydrochloric Acid Er Ar Grade, Iso Propyl Alcohol Propan 2 Olar Grade, L Glutamic Acid 99Percentage, Liq.Ammonia Solution 0.91About 25Percentage Nh3, Manganese Ii Sulphate Monohydrate 99Percentage, Mercuric Chloride Ar Grade, Mercuric Sulphate Ar Grade, Methanol Dried Ar Grade, Methyl Orange Indicator Powder Ar Grade, Methyl Red Indicator Powder Ar Grade, Methyl Thymol Blue Ar Ar Grade, Methylene Blue Staining Powder Ar Grad, Metol 99Percentage Acs Ar Grade, N Hexane 99Percentage Ar Grade, Nitric Acid 69 72Percentage Er Ar Grade, Ortho Phosphoric Acid 88 93Percentage Er, O Toluidine 99.5Percentage Ar Grade, Oxalic Acid Er Ar Grade, Pararosaniline Chloride 88Percentage Ar Grade, Petroleum Spiripetroleum Ether40 Deg 60 Deg C, Phenol Detached Crystals 99.5Percentage Ar Grade, Phenolphthalein Indicator Powder, Potassium Chromate Ar Grade, Potassium Dichromate Ar Grade, Potassium Dihydrogen Ortho Phosphate Er, Potassium Hydroxide Pellets Er Ar Grade, Potassium Iodide Ar Grade, Potassium Metabisulphite 96Percentage Ar, Potassium Nitrate Er Ar Grade, Potassium Permanganate 99Percentage Ar Or Acs, Rochelle Salt, Silver Nitrate Ar Grade, Sodium Acetate Anhydrous Er, Sodium Acetate Trihydrate Er, Sodium Arsenite Ar Grade, Sodium Azide Ar Or Sq Grade, Sodium Bisulphite Ar Or Acs Ar Grade, Sodium Carbonate Anhydrous Ar Grade, Sodium Chloride Er Ar Grade, Sodium Dihydrogen O Phosphate Dihydrate, Sodium Hydrogen Carbonate Sodium Bicarb, Sodium Hydroxide Pellets Er Ar Grade, Sodium Hypochlorite Soln 4 6Percentagechlorine, Sodium Iodide Gpr Ar Grade, Sodium Metabisulphite Er Ar Grade, Sodium Metasilicate Nonahydrate, Sodium Nitrate 99Percentage Ar Or Acs Ar Grade, Sodium Nitroprusside Dihydrate Ar, Sodium Oxalate Ar Or Sq Grade, Sodium Sulphite Anhydrous Er, Sodium Thiosulphate Anhydrous 98Percentage Ar, Sulphamic Acid 99.5Percentage Ar Grade, Sulphanilamide Sulfanilamide 99Percentage, Thiosemicarbazide 98Percentage Ar Grade, Thymol Blue Indicator Powder Ar Grade, Tinii Chloride Anhydrous 98Percentage, Toluene Er Ar Grade, Tri Sodium Phosphate Anhydrous 99Percentage Ar, Universal Indicatorph 4 11 Ar Grade, 1 10 Phenanthroline Ar Or Higher, 1 Amino 2 Naphthol 4 Sulphonic Acid, 5 2 6 Kfrkf Reg Pyridine Free Solution, Biuret For Fertilizer Analysis 1 Gm P, Boric Acid Er Ar Or Higher Grade, Buffer Tablets Ph 4.0, Buffer Tablets Ph 7.0, Buffer Tablets Ph 9.2, Chlorotex Reagent, Citric Acid Anhydrous Ar 99.5Percentage., Diacetyl Monoxime 99Percentage, Ferroin Indicator Solution Ar Or Higher, Hydrogen Peroxide Solution 30Percentage W Or V, Indicator Papersph 1.0 To 14.0, Iodine Resublimed 99.8Percentage, Labolene Neutral Ph Ar Or Higher Grade, Magnesium Chloride Hexahydrate Er, Magnesium Sulphate Heptahydrate 99.5Percentage Ar, Mercuric Iodide Red Ar Or Higher Grade, Methanol For Hplc Ar Or Higher Grade, Neda Ar Or Higher Grade, Nessler S Solution, P Dimethyl Amino Benzaldehyde, Potassium Bromate 99.8Percentage, Potassium Hydrogen Phthalate, Potassium Iodate, Salicylic Acid 99.5Percentage, Silver Sulphate, Sodium Dihydrogen O Phosphate Anhydrous, Sodium Fluoride Er, Sodium Nitrite Er, Sodium Sulphate Anhydrous, Sodium Thiosulphate Pentahydrate Er, Starch Soluble Er Ar Or Higher Grade, Water For Hplc Ar Or Higher Grade, Zinc Acetate Dihydrate 99.5Percentage, N N Diethyl P Phenylenediamine Sulfate, Potassium Hydrogen Phosphate, Potassium Cyanide Ar Or Higher, Hydroxylamine Hydrochloride Ar Or Higher, Copperii Sulfaten Anhydrous Powder, Activated Charcoal Phospherous Free Ar, Potassium Persulphate Er Ar Grade, Ammonium Metavanadate Ar, Ammonium Oxalate Monohydrate 99.5Percentage Ar Or Ac, Di Ammonium Hydrogen Orthophosphate 98 Percentage, Zinc Metal 99.5 Percentage Granulated Cas 744, Bromine Water Cas 7726 95 6, Tri Sodium Citrate Cas 68 04 2, Ammonium Bicarbonate Ar Or Higher Gra, Tri Sodium Orthophosphate Cas 10101 89, Tashiros Indicator Cas 67 56 1, Calcium Acetate Cas 62 54 4, Trisodium Phosphate Cas 7601 54 9, Manganese Chloride Tetrahydrate 99Percentage Cas, Sodium Bromide Cas 7647 15 6, Semicarbazide Hydrochloride 99Percentage Cas 56, Dithizone Cas 60 10 6, Curcumin Reagent Ar Or Higher Grade, Glycine Ar Or Higher Grade Cas No., Wijs Solution Ar Or Higher Grade Ca, Rodine 115 Or Rodine 95 Acid Inhibitor 9, N N Dimethyl P Phenylenediamine Sulfate, Thymolphthalein Indicator Cas 125 20 2, Barium Hydroxide Ar Grade Cas 17194 00 2

Ref. Document
View Tender
#TBR: 33653736 Closed

Aluminium

  • Orissa
  • Due On: 06 Jan, 2025 (0 Days Left)

Supply of V - Belts - Endless V - Belt for Industrial Purposes as per IS 2494, V - Belts - Endless Narrow V - Belts for Industrial use as per IS 14261, Antimicrobial Hand Wash (V2), Jersey Mens Woollen 'V' Neck (Defence), Line Interactive UPS with AVR (V2), Ammonium Metavanadate, XLPE Cable for Working Voltages up to and Including 1.1 KV as per IS 7098 (Part 1), uniform jersey woolen ribbed v neck dgsd specification, Diethyl Phenyl Acetamide 50% (DEPA 50%) - Defence, Diethyl Phenyl Acetamide 20 % (Depa 20 %) (Defence)

Ref. Document
View Tender
#TBR: 33490683 Closed

Electrical Products

  • Uttar Pradesh
  • Due On: 27 Dec, 2024 (0 Days Left)

Supply of V - Belts - Endless V - Belt for Industrial Purposes as per IS 2494, V - Belts - Endless Narrow V - Belts for Industrial use as per IS 14261, Jersey Mens Woollen 'V' Neck (Defence), Insulation Tester, Ammonium Metavanadate, uniform jersey woolen ribbed v neck dgsd specification, Small Angle Grinders, Diethyl Phenyl Acetamide 50% (DEPA 50%) - Defence, Diethyl Phenyl Acetamide 20 % (Depa 20 %) (Defence), Wooden block

Ref. Document
View Tender
Download Document