"नये भारत का नया Tender Portal"
Request a call back

glutaraldehyde Tenders | Latest Tenders for glutaraldehyde

Tender Bharat Website covers all Tenders for glutaraldehyde – Including glutaraldehyde Government Tenders, e Tender glutaraldehyde, glutaraldehyde Tenders and Private Tenders. There is no shortage of business opportunities from the largest glutaraldehyde Tender Database.

Our website allows you to find glutaraldehyde tenders online quickly and easily. Subscribers can also opt to receive daily tender alerts through email from TenderBharat.com to guarantee they don't miss out on any opportunities.

glutaraldehyde Tenders

Total 323 glutaraldehyde tenders found
#TBR: 34643170 Live

Education And Research Institutes

  • Kerala
  • Due On: 30 Jun, 2025 (8 Days Left)

Gem Bids For 10 Doxorubicin Starch Soluble Genipin Paraformaldehyde Span 80 S6760 Polyvinylalcohol Polyvinylalcohol 98 Percen Tannic Acid A R

Ref. Document
View Tender
#TBR: 34626972 Closed

Electrical Products

  • Uttaranchal
  • Due On: 16 Jun, 2025 (0 Days Left)

Gem Bids For 50 V2 Q3

Ref. Document
View Tender
#TBR: 34493997 Closed

Health Services And Equipments

  • Maharashtra
  • Due On: 30 May, 2025 (0 Days Left)

Gem Bids For Consumables, 38 Mitopq Mitochondria-targeted Redox Cycler 25 Mg Cat No. Ab146819 Abcam 8-hydroxy 2 Deoxyguanosine Elisa Kit Cat No. Ab201734 Blue Star Cover Glasses Circular - Special 12 Mm Circular No.1 Bluestar 039 Phix Control V3 Cat No. 15017666 Illumina Rabbit Igg Horseradish Peroxidase-conjugated Antibody Cat- Haf008 R And D Systems Paraformaldehyde 100 Gram Cat No. 158127 Sigma Solution 500 Ml Cat No. 354400 Fanca Gene Sequencingand Analysis By Mlpa Using Blood Or Extracted Dna Sample Whole Exome Sequencing With Minimum Coverage Of 250x It Should Be Cap Accredited For Molecular Diagnosis And Provide Graphical User Interface For All Raw Data Files Histopaque-1077 Sterile-filtered Density- 1.077 G Ml 100ml

Ref. Document
View Tender
#TBR: 34428462 Closed

Security Services

  • Gujarat
  • Due On: 15 May, 2025 (0 Days Left)

Gem Bids For Tab Paracetamol 650 Mg , Tab Zerodol , Tab Voveron 75 Mg , Inj Voveron , Tab Brufen 200 Mg , Syp Brufen , Inj Pcm Infusion 1 Gm 100 Ml Bott , Tab Naproxen 250mg , Syp Pcm 250 Mg , Tab Combiflam , Tab Etoricoxib 120 Mg , Syp Fexofenadine , Budesonide Respules , Tab Cipzox , Syp Albendazole , T Metformin 500 Mg And Sita 50 Mg , Tab Fluconazole 150 Mg , Tab Itraconazole 100mg , Tab Metronidazole 400 Mg , Tab Ondan 8 Mg , T Methylcobalamine 1500mcg , Mouth Ulcer Gel , Tab Atorvas 20 Mg , Tab Ticagleror 90 Mg , T Atorvas 10mg , T Envas 10 Mg , T Ramipril 2 Point 5 Mg , T Metoprolol Xl 25 Mg , T Ecosprin 75 Mg , T Clopid 75 Mg , T Metoprolol Xl 50 Mg , Tab Telmisartan 40 Mg , T Losartan 25 Mg , T Prazocine Xl 5mg , T Ramipril 5 Mg , T Ramipril 10 Mg , T Enavas 5mg , T Telma 40mg And Hctz 12 Point 5 Mg , Chlorohexidine Mouth Wash , Calamine Lotion 100 Ml , Oint Metronidazole , Oint Mupirocin , Povidone Iodine Gargle Soln , 5 Ltr , Hydrogen Peroxide Soln 400ml , T Meftal Spas , Tab Antacid , T Chymoral Forte , Inj Rantac 50 Mg 2 Ml , Sporolac Sachet , No Pile Cream , Inj Hyoscine Bromide , Isabgol Husk , Ors Pkt , T Metformin Sr 1gm , T Dydrogesteron 10mg , T Glimepride 1 Mg , T Glimepride 2 Mg , T Voglibose 0 Point 2 Mg , T Sitagliptin 100 Mg , T Vildagliptin 50 Mg , T Met 1000mg And Sita 50mg , T Empagliflozin 10 Mg , T Empagliflozin 25 Mg , T Vilda 50mg And Met 500 Mg , Inj Insulin Glargin 100 Iu 3 Ml , Eye Drop Ciproflox , Syp Azithromycine 200 Mg Per 5 Ml , Aerocort Rotocaps Bott Of 60 Caps , Levolin Mdi , Levolin Respules , Syp Bromhexine , Syp Tbh , Cap Tamsulosin Point 4 Mg , Tab Vit C 500mg , T B Complex , Inj Nuerobion Forte 3ml , Tab Multi Vitamin , T Etoricoxib 90 Mg , T Augmentin 625 Mg , T Augmentin 1 Gm , Syp Augmentin 228 Mg , Inj Augmentin 1 Point 2 Gm , Tab Azithro 250 Mg , Tab Cefixime 100mg , Tab Cefixime 200mg , T Thyroxin 75 Mcg , T Dapagliflozin 10 Mg , Trop T Kit , T Voglibose 0 Pint 3 Mg , Sterile Surgical Gloves 7 Point 5 , Syringe 5ml , Syringe 10ml , Edta K3 Vaccutainer , Sterile Vaccutainer With Gel , Sodium Fluoride Vaccutainer , Orthocast Softroll 10 By 3 Mtr , Orthocast Softroll 15 By 3 Mtr , Roller Bandage 5 Cm , Roller Bandage 10 Cm , Crepe Bandage 10 Cm , Triangular Bandage , Gauze For Dressing 90 By 16 Mtr , Dengue Kit , Typhoid Rapid Kit , Cholesterol Erba Kit 5 By 30 Ml , Glucose Kit 5 By 60 Ml , Urea Kit 4 By 30 Ml , Erba Uric Acid Kit , Creatinine Kit , Sgot Kit , Sgpt Kit , Albumin And Glucose Strip Of Bottle 100 , Rabipur Vaccine , Ed Waxol , Vit D3 Drop 400 Iu Per Ml , Knee Cap , Stromatolyser Bott Of 500 Ml , Cell Clean , Cell Pack Solution 20 Ltr , T Rosuvastatin 20mg , Digital X Ray Film 8 By 10 Inch Pkt Of 150

Ref. Document
View Tender
#TBR: 34373870 Closed

Security Services

  • West Bengal
  • Due On: 30 Apr, 2025 (0 Days Left)

Gem Bids For E Ifa Re 16 Rifaximine 550 Mg Tab , E Ifa Re 16 Rivaroxaban 2 Dot 5 Mg Tab , E Ifa Re 16 Rivaroxaban 20 Mg Tab , E Ifa Re 16 Rizatriptan 5 Mg Tab , E Ifa Re 16 Ropinirole 0 Dot 5 Mg Tab , E Ifa Re 16 Rosuvastatin 10mg Aspirin 75mg Tab , E Ifa Re 16 Rosuvastatin 10 Mg Tab , E Ifa Re 16 Rosuvastatin 20 Mg Tab , E Ifa Re 16 Rosuvastatin 40 Mg Tab , E Ifa Re 16 Rotacap Glycopyrronium Powder For Inhalation 50 Mcg , E Ifa Re 16 Rotacap Salbutamol 200mcg Asthalin , E Ifa Re 16 Rotahaler , E Ifa Re 16 S Adenosyl L Methionine 400 Mg Tab Adesam , E Ifa Re 16 S Amlodipine 2 Dot 5 Mgtab , E Ifa Re 16 Salbutamol 200 Mdi Each Metered Dose Supplies 100mcg Of Salbutamol Mdi , E Ifa Re 16 Saline Nasal Drops , E Ifa Re 16 Salmeterol 50mcg Fluticasone Propionate 250mcg Seretide Accuhaler 50 250 , E Ifa Re 16 Salmeterol 50mcg Fluticasone Propionate 500mcg Accuhaler , E Ifa Re 16 Savlon Liquid Bott Of 1 Ltr , E Ifa Re 16 Scalp Vein Set , E Ifa Re 16 Semaglutide 3 Mg Tab , E Ifa Re 16 Serratiopeptidase 10 Mg Tab , E Ifa Re 16 Sertraline 25 Mg Tab , E Ifa Re 16 Sevelamer Foseal 800 Mg Tab , E Ifa Re 16 Silodosin 4 Mg Tab , E Ifa Re 16 Silodosin 8 Mg Dutasteroide 0 Dot 5 Mg Tab , E Ifa Re 16 Silver Nitrate Chlorhexidine Oint Burnheal , E Ifa Re 16 Silver Sulfadiazine 1 Oint 500 Gms Jar , E Ifa Re 16 Silver Sulfadiazine Oint , E Ifa Re 16 Silymarin 70 Mg Tab , E Ifa Re 16 Sitagliptin 50 Mg Tab , E Ifa Re 16 Slid Glass , E Ifa Re 16 Sod Picosulphate Cremelax 10 Mg Tab , E Ifa Re 16 Sod Valproate 200 Mg Cr Tab , E Ifa Re 16 Sodium Bicarbonate 1000 Mg Tab , E Ifa Re 16 Sodium Chloride 6 W W Eye Oint Hypersol 6 , E Ifa Re 16 Sodium Chloride 5 Eye Drops E D , E Ifa Re 16 Sodium Chromoglycate 2 Bott Of 10 Ml Eye Drops Cromal E D , E Ifa Re 16 Sodium Hypochlorite Bott Of 500 Ml , E Ifa Re 16 Sodium Valproate 300 Mg Tab Cr , E Ifa Re 16 Sodium Valproate 500 Mg Tab , E Ifa Re 16 Sodium Valproate Oral Sol 200mg 5ml Bott Of 100 Ml , E Ifa Re 16 Sofosbuvir 400mg Velpatasvir 100mg Cap , E Ifa Re 16 Solifenacin 10 Mg Tab , E Ifa Re 16 Solifenacin 5 Mg Tab Soliten , E Ifa Re 16 Soln 2 Disinfectant , E Ifa Re 16 Vildagliptin 50mg Tab , E Ifa Re 16 Vitamin B Complex With A Minimum Concentration Of Vit B1 5 Mg Vit B6 3 Mg Vit B12 5 Mcg Therapeutic Tab Cap , E Ifa Re 16 Warfarin 5 Mg Tab , E Ifa Re 16 Xylometazoline 10 Ml Nasal Drop , E Ifa Re 16 Zolpidem 10 Mg Tab , E Ifa Re 16 Barrier Cream 4720

Ref. Document
View Tender
#TBR: 34332901 Closed

Health Services And Equipments

  • Uttar Pradesh
  • Due On: 25 Apr, 2025 (0 Days Left)

Gem bids for 2000 V2 Q3

7.27 Lacs
View Tender
#TBR: 34288643 Closed

Security Services

  • West Bengal
  • Due On: 22 Apr, 2025 (0 Days Left)

Gem Bids For D Ifa Re 13 Decapeptide 10mg Lot 10ml Bott , D Ifa Re 13 Diphtheria Tetanus Acellular Pertussisdtap Single Dose Vaccine , D Ifa Re 13 Inj Gadobutrol 1dot0mmolml 10ml Vial , D Ifa Re 13 Umbilical Catheter 3dot5 Fr , D Ifa Re 13 Tracheostomy Tube 8mm With Cuff And Two Inner Cannula , D Ifa Re 13 Sodium Perborate Monohydrate 50 Ww Solution Parasafe , D Ifa Re 13 Inj Noval Rabies Monoclonal Antibody Containing Docaravimav And Miromavimab 1500iu2dot5ml , D Ifa Re 13 Locking Reconstruction Plate 3dot5mm Titanium 14 Hole With Twelve 3dot5mm Locking Head Titanium Screws , D Ifa Re 13 Locking Reconstruction Plate 3dot5mm Titanium 10 Hole With Ten 3dot5mm Locking Head Titanium Screws , D Ifa Re 13 Locking Reconstruction Plate 3dot5mm Titanium 12 Hole With Twelve 3dot5mm Locking Head Screws , D Ifa Re 13 Neonatal Central Venous Triple Lumen Catheter Central Line Size2dot5fr , D Ifa Re 13 Cpap Disposable Tubing With Water Chamber And Humidifier Chamber , D Ifa Re 13 Bipolar Marryland Vessel Sealer 5mm , D Ifa Re 13 Neonatal Central Venous Triple Lumen Catheter Central Line Size3dot0fr , D Ifa Re 13 Endopath Endoscopic Bowl Clamp With Ratchet , D Ifa Re 13 Disposable Perforator For Craniotomy Atraumatic Tip 14mm , D Ifa Re 13 Thalidomide 100mg Cap , D Ifa Re 13 Antimicrobial Skin Cleaning Wipes Polyhexanide Based Pack Of 1012 Wipes , D Ifa Re 13 Vitb Complex Forte With Ascorbic Acid Cap , D Ifa Re 13 Cyclosporine 50mg Tabcap , D Ifa Re 13 Thiocolchicoside 4mg Captab , D Ifa Re 13 Vit D3 100 Iu Folic Acid 1mg Mayoinositol 2000mg Sachet5 Gm Each Pack Of 30 , D Ifa Re 13 Glycolic Acid 6 Cream 30 Gm Tube , D Ifa Re 13 Octinoxateniacinamideglycolic Acid 3kojic Acid Dipalmitatearbutinmulberry Extract1 Tocopheryl Acetateallantoinlicoric Extract Tetrahydrocurcumin30gm , D Ifa Re 13 Crystal Trichloroacitic Acid 100 , D Ifa Re 13 Gel Sunscreen Gel Spf40 60gmoctinoxatediethylamino Hydrobenzoyl Hexyl Benzoatebisethyloxyphenol Methoxyphenyl Microfine , D Ifa Re 13 Hair Rremoval Contains Watermineral Full Nomenclature In Pdf Format , D Ifa Re 13 Hand Disinfectant 32dot5 Gm Propanolol1 18 Gm Etahol 0dot1 Gm Bott Of 250 Ml Liq , D Ifa Re 13 Liquid Disinfectant Each 05 Lit Contains Sodium Chloride 605 Gm Potassium Chloride 10 Gm Sod Bi Carbonate 15 Gm In Buffer Solution Qs And Stabilizer Qs Can Of 5 Ltrsterisol , D Ifa Re 13 Betamethasone 0dot05 Zinc Sulfate 0dot5 Lotion 50ml Bott , D Ifa Re 13 Desonide 0dot05 Ww Gel 20gm , D Ifa Re 13 Paracetamol 500mg Caffeine 65mg Tab , D Ifa Re 13 Neomycin Pulv Bott 5 Gm , D Ifa Re 13 Serum Vit K Under Eye Serum 30 Ml , D Ifa Re 13 Ketoconazole Ichthyal Pale Dpanthenol Alovera 10 75ml Shampoo , D Ifa Re 13 Diazepam Suppository , D Ifa Re 13 Paracetamol 250mg Suppository , D Ifa Re 13 Surgical Scrub 2 Chlorhexidine In 70 Ethyl Alcohol Without Any Moisturizers Bott Of 500 Ml , D Ifa Re 13 Cefpodoxime Oral Suspension , D Ifa Re 13 Ofloxacin Orinidazole Syp 30 Ml Bottle , D Ifa Re 13 Oseltamivir 12mgml Syp , D Ifa Re 13 Alfuzocin 10mg Dutasteride 0dot5mg Tab , D Ifa Re 13 Amoxycillin 250mg Clavulanic Acid 50mg Tab , D Ifa Re 13 Calcium Carbonate 250 Tab , D Ifa Re 13 Itopride 100mg Tab , D Ifa Re 13 Chlordiazepoxide 5mg Clinidium 2dot5mg Tab , D Ifa Re 13 Mesalamine 200mg Tab , D Ifa Re 13 Metalozone 5mg Tab , D Ifa Re 13 Montelukast 10mg Tab

Ref. Document
View Tender
#TBR: 34278412 Closed

Health Services/equipments

  • Manipur
  • Due On: 16 Apr, 2025 (0 Days Left)

Gem Bids For Hydroxyethyl Starch , Adenosine , Adrenaline , Amikacin 250 Mg , Amikacin 375 Mg , Amikacin 500 Mg , Amikacin100 Mg , Amiodarone , Amoxicillin , Amoxicillin 250 Mg And Clavulanic Acid 50 Mg Inj , Amoxicillin 500 Mg And Clavulanic Acid 125 Mg Tab , Antacid Gel , Atracurium Besylate , Atropine , Azithromycin 500 Mg Tab , Betadine Mouth Gargle , Bicarbonate Solutions , Botropase , Bupivacaine , Butorphenol , Calcium Gluconate , Cefoperazone Sulbactam , Cefotaxime 125 Mg , Cefotaxime 250 Mg , Ceftriaxone 1 Gm , Ceftriaxone 125 Mg , Ceftriaxone 250 Mg , Ceftriaxone 500 Mg , Ceftriaxone With Sulbactum 1.5 Gm , Ceftriaxone With Sulbactum 375 Mg , Ceftriaxone With Sulbactum 750 Mg , Chlorhexedine Gluconate Soln , Cis-atracurium , Desflurane , Dexamethasone , Dexmedetomidine , Dextrose 10 Percent 500 Ml Iv Inj , Dextrose 25 Percent 100 Ml Iv Inj , Dextrose 5 Percent 500 Ml Iv Inj , Dextrose 5 Percent And Sodium Chloride 0.9 Percent 500 Ml Iv Inj , Diclofenac Aq , Dobutamine , Dopamine , Doxophylline , Eldex P , Enoxaparin 40mg , Enoxaparin 60mg , Esmolol , Etophylline And Theophylline , Fentanyl Citrate , Frusemide , Neutralyser , Solution , Glycopyrrolate Neostigmine Methylsulphate , Glycopyrrolate , Hand Sanitizer , Heloperidol , Heparin , Human Normal Albumin , Hydrocortisone , Hydrogen Peroxide 30 Percent , Hydrogen Peroxide 6 Percent , Sugammadex , Isoprenaline , Ketamine , Labetalol , Levofloxacin , Lignocaine 2 Percent 30 Ml , Lignocaine 2 Percent Jelly , Lignocaine 2 Percent With Adrenaline , Lignocaine 4 Percent 30 Ml , Lignocaine Hydrochloride 2 Percent , Lorazepam 2 Ml Inj , Mvi Inj , Magnesium Sulphate , Mannitol 20 Percent 100 Ml , Mephentermine , Meropenem 1 Gm , Meropenem 250 Mg , Meropenem 500 Mg , Methylprednisolone Acetate , Metoclopramide , Metronidazole , Midazolam , Morphine Tab , Morphine Inj , Mupirocine Ointment , Naloxone , Neostigmine , Neutral Detergent , Nitroglycerin , Nor Adrenaline , Ofloxacin And Ornidazole , Octreotide , Ondansetron , Oral Rehydration Salt , Oxytocine , Pantoprazole Tab , Pantoprazole Inj , Paracetamol Inj , Paracetamol 500 , Paracetamol 650 , Paracetamol Iv Inj , Pentazocine , Pethidine , Pheniramine Maleate , Phenobarbidone , Phenytoin Sodium , Piperacillin And Tazobactum 1.125 Gm Inj , Piperacillin And Tazobactum 2.250 Gm Inj , Piperacillin And Tazobactum 4.5 Gm Inj , Potassium Chloride , Povidone Iodine 10 Percent Solution 500 Ml , Povidone Iodine 5 Percent Solution 500 Ml , Povidone Iodine Ointment , Prilox Cream , Promethazine 2 Ml , Propofol 1 Percent 20 Ml Inj , Rl Iv Inj , Rabies Vaccine Human , Ranitidine , Rectified Spirit , Rocuronium Bromide , Ropivacaine , Sevoflurane , Snake Venom Antiserum , Sodium Bicarbonate , Sodium Chloride 100 Ml Iv Inj , Sodium Chloride 1000 Ml Iv Inj , Sodium Chloride 500 Ml Iv Inj , Sodium Chloride 3 Percent 100 Ml Iv Inj , Sodium Hypochlorite , Succinylcholine Chloride , Teicoplanin , Tetanus Toxoid , Tinidazole , Tpn Solution , Tramadol , Tranexa Inj , Tranexamic Acid Tab , Tuberculin Purified Protein Derivative , Vancomycin , Vecuronium Bromide , Vitamin K , Water For Injection

Ref. Document
View Tender
#TBR: 34278450 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 16 Apr, 2025 (0 Days Left)

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

Ref. Document
View Tender
#TBR: 34273612 Closed

Banking And Mutual Funds And Leasings

  • Delhi
  • Due On: 15 Apr, 2025 (0 Days Left)

Gem Bids For Disposable Needles 18 Gauge 1 Point 5 Length , Disposable Needles 23 By 24 Gauge 1 Length , Disposable Needles 26 Gauge 1 Point 5 Length , Cotton Bandage Roll , Bandage Than Absorbant Gauge Cloth , 5 Percent W By V Povidone Iodine Solution , 2 Point 45 Percent Solution , Absorbant Cotton Roll , Disposable Sterile Sample Culture Bottle , Desnet Aldehyde And Phenol Free Non Corosive Environment 1 Lit , Disposable Non Woven Bedsheet Blue , Sterile Disposable Syringe With Needle 10 Ml Syringe With 21 Gauge , Sterile Disposable Syringe With Needle 2 Ml Syringe With 24 Gauge 1 Needle , Sterile Disposable Syringe With Needle 5 Ml Syringe With 24 Gauge 1 Needle , Elastic Zinc Oxide Self Adhesive Bandage , Edta Non Vaccum Blood Collection Tube 4ml , Latex Medical Examination Gloves Powdered Iso Certified Medium Bar Small , Absorbent Cotton Gauze Than , Glucostrip-accu Sure Soul One Box Of 100 Strips , Glucostrip-codefree One Box Of 50 Strips , Non-woven Disposable Bouffant Head Cap With Elastic Band Blue Colour , Non-woven Disposable Hiv Pack For Personal Protection For Hospital Use Sterile , Hydrogen Peroxide , Inj Diclofenac Sodium Ip , Insulin Syringe With Fixed 30g Bar 31g Needle , Local Anaesthesia 2percentage Lignocaine Hydrochloride With Adrenaline , Microporous Surgical Adhesive Tape , Nitrile Gloves For Examination Size Medium Powder Free Blue3 Colour , Normal Saline Sodium Chloride Inj Ip , Plain Vacutainer Non Vaccum Blood Collection Tube 4ml Red Colour , Alcohol Based Hand Sanitizer , Chlorhexidin Gluconate Ip , Disposable Shoe Cover Non Woven Fabric Blue Colour Elastic Band For Fit , Silk Suture 3 Hypen 0 Three Bar 8 Circle 16 Mm 12pcs , Silk Suture 3 Hypen 0 Ns 5028 Seam Silk Three Bar 8 Circle 26 Mm 12 Pcs , Silk Suture 4 Hypern 0 One By Two Circle 16mm , Silk Suture 4 Hypen 0 3 By 8 Circle 16mm , Silk Suture 5 Hypen 0 3by8 Circle 16mm , 3 Percent Sodium Hypochlorite For Dental Use , Sodium Hypochlorite 5 Percent By 10percent , Soframycin Ointment 30g , 3ply Surgical Face Mask , Sterile Surgical Latex Gloves 6.5 , Sterile Surgical Latex Gloves 7 , Disposable Non Woven Surgical Gown , Surgical Spirit For Hospital Use , Detachble Bard Parker Surgical Blade No 11 Stailess Steel , Detachble Bard Parker Surgical Blade No 15 , Toilet Paper Roll Plai White 2ply , Vaseline White Softparaffin , Polyglactin Absorbable Suture 3 Point 0 90cm Length , Polyglactin Absorbable Suture 3 Point 0 70 To 90 Cm Length , Polygactin Absorbable Suture 4 Poit 0 , Lignocaine Hydrochloride Jelly , Copper Sulphate , Coverslips 22mm 50mm Point Zero Eight To Point One Three Mm Thickness , Creatinine Kit , Crystal Violete 125 Ml , Dextrose Glucose , Disposable High Profile Blade For Microtome , Disposable Plastic Tissue Embedding Ring , Dpx Mountant , Ethanol , Filter Paper Whatmen , Formalin 5lt , Fructose , Glass Slide 50psc , Glass Slides , God By Pod Sugar Kit , Gram Iodine , Hydrochloric Acid , Hydrochloric Acid Nby10 Hcl , Immersion Oil , Inoculating Loop With Holder , Isopropyl Alcohol , Leishman Stain , Liquid Ammonia , Litmus Paper Blue , Litmus Paper Red , Maltose , May Grunwald Giemsa Stain , Methylene Blue , Molisch Reagent , Paraffin Wax , Protein Estimation Kit , Saffranine , Sodium Carbonate , Sodium Nitroprusside , Specimen Jar With Lid , Sucrose , Sulphur Powder , Sulphuric Acid , Test Tubes 15 125mm , Test Tubes 15 150mm , Uric Acid Kit , Xylene , Yellow Tips

Ref. Document
View Tender
Download Document