Tender Bharat Website covers all Tenders for lactose – Including lactose Government Tenders, e Tender lactose, lactose Tenders and Private Tenders. There is no shortage of business opportunities from the largest lactose Tender Database.
Our website allows you to find lactose tenders online quickly and easily. Subscribers can also opt to receive daily tender alerts through email from TenderBharat.com to guarantee they don't miss out on any opportunities.
Supply Of Ipbp Ass Not More Than 0.1 Percent By Wt. And Moisture Not More Than 1 Percent
Supply Of 1. Balanced Nutrition For Renal Care. Calorie Dense 2 Kcal/ml. Not Less Than 13g/100 G Protein Only In Form Of Whey Protein Concentrate, Low In Electrolytes, Sodium Not More Than 100 Mg/100g, Potassium Not More Than 120 Mg/200g, Phosphorous Not More Than 150 Mg/100g .enriched In Carnitine And Taurine. Low Gi Carbohydrate- Fructose Based, Safe For Diabetes. , Gluten & Cholesterol Free. Delicious Vanilla Flavor 400 Gram Tin 2. Balanced Nutrition For Hepatic Care. Calorie Dense 1.5kcal/ml, At Least 17.5g/100 G Protein In Form Of Whey Protein Concentrate, 70% Of Total Fat In Form Of Mct At Least 6.3 G/100g . Enriched In Bcaa, Leucine Not More Than 1.8g/100g. Sodium Not More Than 120mg/100g. Fructose Based. Sucrose Free. Safe For Diabetics. Gluten Free. Delicious Vanilla Flavor 400 Gram Tin.
Ip Bp Ass Not More Than 01 Percent By Wt And Moisture Not More That 01 Percent
Gem Bids For Acetic Acid Glacial , Acetocarmine For Microscopical Staining , Acetone Ar Or Analytical 99.5 Percentage , Agarose Low Eeo Regular Grade , L-alanine For Biochemistry , Ammonium Chloride Ar , Ammonium Chloride Extra Pure Grade 99percentage , Ampicillin Sodium Salt For Molecular Biology , L-aspartic Acid Pure , Abo And Rhd Blood Group Kit , Alpha-naphthol , Ammonium Hydroxide , Ammonium Sulphate , Barfoed Reagent-ar , Benedicts Reagent , Boric Acid , Bovine Serum Albumin Fraction , Bromophenol Blue Dye For Molecular Biology , Bromine Water , Calcium Carbonate Precipitated Meets , Barium Chloride , Basic Fuschsin , Benzidine Powder , Benzene , Bilirubin Glucouronide , Casein Acid Hydrolysate Vitamin Free , Chloroform , Copper Sulphate Anhydrous , Crystal Violet Stain For Microscopy , Charcoal Activated Decolorizing Powder , Colchicine Lr For Microscopy , Virgin Coconut Oil Pure , Cholesterol Ar , Ethanol Ethyl Alcohol , Eosin Yellow, Practical Grade , Egg Albumen Solid Powder , Eriochrome Black-t , Cod Liver Oil , Ethylene Diamine Tetra Acetic Acid , Ethidium Bromide , Fehlings Solution A Grade , Fehlings Solution B Grade , Folin And Ciocalteus Phenol Reagent , Ferric Chloride Anhydrous , Formaldehyde Solution , Fouchet Reagent , D-glucose , Giemsas Stain , Gentian Violet Powder , Glycine Pure 99.00 Percentage , Glycerine Or Glycerol , D- Fructose Pure , D- Ga Lr , Haematoxylin Stain Certified For Microscopy , Hepes Sodium Salt Buffer , Hydrochloric Acid Lr , Hydrogen Peroxide Solution Ar 30 Percentage , Iodine Lr , 2- Propanol Iso-propyl Alcohol 99.0 Percentage , Potassium Iodide Ar Or Acs , Potassium Hydrogen Sulphate , Safranin -o Stain For Microscopy ,
Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G
Supply Of Dpph , Luria-bertani Broth , Gelatin Solution , Glucometer Plus 100 Strips , Glyoxalic Acid , T-butyl Alcohol , Magnesium Metal Turning , Mayers Solution , Bials Reagent , Cobalt Chloride Hexahydrate Pure , Carbol Thionine Solution , Picrolonic Acid For Synthesis , Mercury I Mercurous Nitrate 0.1m 0.1n , Deniges Reagent , Potassium Mercuric Iodide Pure , Potassium Iodo Bismuthate , 1,10-phenanthroline Hydrochloride , 1- Naphtholbenzein Extrapure , Acacia Powder , Acetic Acid Glacial , Acetone , Aluminium Sulphate , Ammonium Thiocyanate Acs , Aniline , Aspirin- Acetylsalicylic Acid , Barium Chloride , Benzoic Acid , Benzoin , Benzyl Chloride , Bromocresol Green Solution , Bromothymol Blue Solution , Calcium Carbonate , Carbon Tetrachloride , Cerium Iii Sulphate , Chloral Hydrate , Chloroform , Cochineal Natural Red 4 , Copper Oxide Black , Phenol Detached Crystals , Diastase -fungal , Dibutyl Phthalate Pure , Edta Disodium Salt Dihydrate Pure , Di-sodium Hydrogen-o-phosphate Anhydrous , Dragendorffs Reagent , Petroleum Ether , Ammonium Ferric Sulphate , Glycerol Monostearate Extra Pure , Grams Iodine , Hydrochloric Acid , Hydroxy Propyl Methyl Cellulose , Iodine Resublimed , Iodine Monochloride Solution , Kaolin Light , , Lauric Acid Pure , Oil Of Lemon , Liquid Paraffin , Liquid Phenol , Magnesium Sulphate , Methylene Chloride , Microcrystalline Cellulose , Morin Hydrate , N-butanol , Nitro Benzene , Orange Oil , Oxalic Acid , Paraamino Benzoic Acid , Paracetamol Powder , P-chloro M-cresol , Perchloric Acid 0.1n In Glacial Acetic Acid , Phenol , Phenolphthalein Extrapure Ar , Phenolphthalein Indicator Soln In Ethanol , Phenyl Mercury Acetate For
Purchase Of Raw Materials- Ip/Bp/Usp Hms Holland
Supply Of Ip
Supply of Nutritionally Balanced Free Complete Diet For Diabetics Powder
Supply of Hydrochloric Acid , Conc. Sulphuric acid , Nitric Acid , Perchloric Acid , Potassium dihydrogen phosphate , Magnesium sulphate heptahydrate , Gluconic acid , Boric acid , Copper sulphate pentahydrate , Molybdenum trioxide , Ferric chloride , HDTMA , Glycerol , Sucrose , Di potassium hydrogen phosphate , Sodium molybdate , Calcium carbonate , two four dinitrophenyl hydragine , Tris HCL buffer , Lead nitrate , Nutrient agar , Gram stain kit , Hi assorted biochemical test kit , Sodium bicarbonate , Picric acid liquid , Glycine , ACC , Slide , Normal glass spreader , Test tube , Ethanol , Test tube rack , PTFE Syringe Filter , Cover Slip , Purple nitrile gloves , Lauryl Tryptose Broth , Brilliant green bile broth , Eosine Methylene blue , Starch Powder , Ethylene diamine tetra acetic acid , Ammonium Solution , Ammonium Hydroxide , Eriochrome Black T , Silver Sulfate , Sulphamic Acid , Mercuric Sulfate , Ferroin Indicator , Calcium Chloride , Magnesium Sulfate , Sodium Azide , Volumetric Flask I , Volumetric Flask II , Volumetric Flask III , Conical Flask I , Conical Flask II , Reagent Bottle , Pipette I , Pipette II , Pipette III , Wash Bottle , Dropper , Pipette sucker , Gloves , Potassium Dichromate , Ferrous Ammonium Sulfate , Diphenylamine , Orthophosphoric acid , Sodium Fluoride , Potassium permanganate , Sodium Hydroxide , Sodium Carbonate , Bromocresol green , Methyl red , Potassium Dihydrogen Phosphate , two four Dinitrophenol , Sodium Bicarbonate , Ammonium molybdate , Ascorbic acid , Antimony Potassium tartrate , Activated charcoal , Calcium chloride , Sulphamic acid , Silver sulphate , Mercuric sulphate , Ammonium chloride , Eriochrome black T , Ethyl alcohol , Phenolphthalein indicator , Potassium phthalate , Methyl alcohol , Tissue Roll , Ammonium hydroxide