"नये भारत का नया Tender Portal"
Tender Bharat Website covers all Tenders for perchloric acid – Including perchloric acid Government Tenders, e Tender perchloric acid, perchloric acid Tenders and Private Tenders. There is no shortage of business opportunities from the largest perchloric acid Tender Database.
Our website allows you to find perchloric acid tenders online quickly and easily. Subscribers can also opt to receive daily tender alerts through email from TenderBharat.com to guarantee they don't miss out on any opportunities.
Gem Bids For Acetone AR Grade Pack Size 2 point 5 Ltrs Make SD Fine or Merck ,Hydrochloric 37 percent AR Grade Pack Size 2 point 5 Ltrs Make SD Fine orMerck , 60Percentage AR Grade Pack Size 500 ml Make SD Fine orMerck ,Acetic AR Grade Pack Size 2 point 5 Ltrs Make SD Fine orMerck ,Copper Sulphate(II) 99.5Percentage AR Grade Pack Size 500 Grams Make SD Fine orMerck ,Sodium Hydroxide Pellets 98Percentage AR Grade Pack Size 500 Grams Make SDFine orMerck ,Sodium Chloride AR Grade Pack Size 5 Kgs Make SD Fine orMerck ,Boric 99 point 5 Percentage LR Grade orExtra Pure Pack Size 500 Grams Make SD Fine orMerck ,Methyl Cellulose 4000 cps LR Grade Pack Size 500 Grams Make SD Fine orMerck ,HPLC Water High Purity Pack Size 1 Ltr Make SD Fine orMerck
Gem Bids For Ethyl Methyl Ketone , Lab Chemical Acetic Glacial , Lab Chemical Acetone , Aniline , Chlorobenzene , Hexane , Hydranal Coulomat , 2 Propanol Sply 2500 Ml Each , 2 Propanol Sply 25 Lt Each , Methanol Form Ch 3oh , Methanol Ch4o , N Heptane C7h16 , , Xylene Cap 2500 Ml , Toluene Cap 2500 Ml , Toluene 25 Liters , Carbon Tetrachloride , Diethyl Ether Sply 500 Ml Each , Lab Chemical Petroleum Spirit , Glycerol Anhydrous , Lab Chemical Acetonitrile , Lab Chemical Cyclohexane , Lab Chemical Chloroform , Lab Chemical Dimethyl Sulphoxide , Iso Octane , Lab Chemical Ethylene Glycol , Lab Chemical Wij Solution , Lab Chemical Hplc Grade Water , Lab Chemical Sulfuric , Hydrochloric , Nitric , Ammonia Solution , Pyridine
Gem Bids For Ammonia Solution 30percent Grade Analytical Reagent Pack Size 5 Ltr , Hydrochloric 35percent Ar Grade Pack Size 5 Ltr With Coa , Nitric Ar Grade 69percent Pure Pack Size 2.5 Ltr With Coa , Ammonium Bifluoride Ar Grade With Coa , Starch Soluble Ar Grade With Coa , Ordinary Filter Paper125mm Dia Grade101 100 Circle Per Pack , Filter Paper No 40ashless Dia12.5cm 100 Circles Per Box , Beaker Griffen Low Form With Spout 250ml Isi Marked , Air Heater Heating Element 5kw 230by400 Cuni 2inch Bsp Flange.ihcu 50by32 Depth Of Immerson 320mm , Ar Grade Min.70percent Assay Packing 2.5 Litre In Glass Bottle With Coa , Apron Cotton White Colour Medium Sixe Full Hand , Apron Cotton White Colour Large Full Hand , Apron Cotton White Colur Xl Full Hand , Apron Cotton Khakhi Colur Large Size Half Hand , Apron Cotton Khakhi Colur Xl Size Half Hand , Respirators Mask Model V 44 Is 9473 2002 Ffp1s , Drill Bit Size 4mm Moc Carbide Tipped , Rubber Hand Gloves 11 Inch Proof For Handling Conc. , Copper Standard Solution 1000 Ppm 500 Ml For Aas Use , Carbondaum Black Silicon Carbide Bench Grinding Wheel Size Bore 32mm Od 150mm Thickness 20mm , Muffle Furnace Fire Safety Hand Gloves Made Of 575 Gsm Aluminized Para Armid Heat Resistant Fabric.11612 2008. Heat Resistant Up To 1000 Deg C. Size 14inch
Gem Bids For Labchem Acetic Glacial Ch3cooh , Labchem Acetone C3h6o , Labchem Ammonium Acetate C2h7no2 , Labchem Ammonium Chloride , Labchem Ammonium Ferrous Sulphate , Labchem Ammonium Hydroxide Nh4oh , Labchem Ammonium Molybdate Nh4 6mo7o , Labchem Boric H3bo3 , Labchem Edta C10h16n2o8 , Labchem Hydrochloric Hcl , Labchem Hydrofluoric , Labchem Hydrogen Peroxide , Labchem Bromocresol Purple I C21h16br2o , Labchem Ebt Indicator , Labchem Methyl Orange Indica C14h14n3na , Labchem Copper Pan Indicator C15h11n30 , Labchem Pr Indicator C21h14n2o7 , Labchem Xylenol Orange Indic C31h32n2o1 , Labchem Sdps Indicator , Labchem Iso Propyl Alcohol , Labchem Labolene Cleaning R , Labchem Mercuric Chloride , Labchem Methanol Ch3oh , Labchem Orthophosphoric H3po4 , Labchem Oxalic C2h2o4 , Labchem Ph Buffer Tablets Ph 4.00 , Labchem Ph Buffer Tablets Ph 7.00 , Labchem Ph Buffer Tablets Ph 9.20 , Labchem Potassium Hydroxide Koh , Labchem Quinoline , Labchem Silicon Grease Lubricant , Labchem Silver Nitrate Agno3 , Labchem Sodium Bi Carbonate Nahco3 , Labchem Sodium Meta Bisulphite Na2s2o5 , Labchem Sodium Potassium Tartrate , Labchem Sodium Sulphate Anhyhrous , Labchem Stannous Chloride Sncl2 , Labchem Stearic , Labchem Sulphuric H2so4 , Labchem Zinc Acetate Zn Ch3co2 2 , Labchem Zinc Oxide , Labchem Benzene , Labchem Glycerol 2.5 L Ex , Labchem Methyl Red Indicator , Labchem , Labchem Sodium Nitrate , Labchem Sodium Peroxide Granular , Labchem Tin Metal , Labchem Ammonium Oxalate Nh4 2c2o4 , Labchem Ammonium Persulphate , Labchem Ammonium Thiocyanate , Labchem Citric C6h8o7 , Labchem Dimethyl Glyoxime C4h8n2o2 , Labchem Ethanol , Chemical Anhydrous Ferric Chloride Fecl3 , Labchem Hydroxylamine Hydrochloride , Nisp Project Material Bromocresol Green , Labchem Potassium Ferricyani K Fe Cn , Labchem Sodium Bisulphite , Labchem Sodium Fluoride Anhydrous , Labchem Zinc Sulphate Hepta Znso47h2o , Labchem Benzoin Oxime , Chromium Oxide Iii Green 500 Gm Pack , Carnauba Wax , Carborandum Powder Mesh 400 , Carborandum Powder Mesh 800 , Carborandum Powder Mesh 1000 , Carborandum Powder Mesh 1200 , Conductivity Standard 12.88us Cm , Conductivity Standard 1413us Cm
Gem Bids For 29 Reagents For Alcohol Project Minimum Average Annual Turnover Of The Years Of Past Experience Required For Mse Exemption For Years Of Experience And Startup Exemption For Years Of Experience Experience Criteria Past Performance Bidder Turnover Certificate Requested In Atc Oem Authorization Certificate Oem Annual Turnover Additional Doc 1 Requested In Atc Additional Doc 2 Requested In Additional Doc 3 Requested In Atc Additional Doc 4 Requested In Atc Compliance Of Boq Specification And Supporting Document *in Case Any Bidder Is Seeking Exemption From Experience / Turnover Criteria The Supporting Documents To Prove His Eligibility For Exemption Must Be Uploaded For Evaluation By The Buyer Do You Want To Show Documents Uploaded By Bidders To All Bidders Participated In No Bid/ Primary Product Category Sodium Tetraborate Time Allowed For Technical Clarifications Inspection Required By Empanelled Inspection Authority / Agencies Pre- No Registered With Gem Arbitration Clause No Mediation Clause No, 30 Sodium Tetraborate Trizma Hydrochloride Tetraethyl Orthosilicate D Plus Glucuronolactone Sodium Methoxide Seventy Percent Hydrogen Bromide Solution In Acetic Silver Carbonate Barium Hydroxide Sulfanilic Ammonium Persulfate Aniline Acetyl Chloride Sodium Acetate Anhydrous 1 4 Butanesultone Potassium Tert Butoxide 3 Pentadecylphenol D Glucuronic Sodium Sulfide Ethyl Alcohol Pure Four Methylumbelliferyl D Glucuronide Hydrate Four Methylumbelliferyl Phosphate Chemical Ethyl Beta D Glucuronide Solution Bovine Serum Albumin Human Serum Albumin Zinc Sulphate Heptahydrate Manganese Ii Chloride Tetrahydrate 3 Mercaptopropyl Triethoxysilane Cetyltrimethyl Ammonium Bromide Ctab
Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric 1000 Ml , 1000 Ml , Glacial Acetic 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G
Supply Of Dpph , Luria-bertani Broth , Gelatin Solution , Glucometer Plus 100 Strips , Glyoxalic , T-butyl Alcohol , Magnesium Metal Turning , Mayers Solution , Bials Reagent , Cobalt Chloride Hexahydrate Pure , Carbol Thionine Solution , Picrolonic For Synthesis , Mercury I Mercurous Nitrate 0.1m 0.1n , Deniges Reagent , Potassium Mercuric Iodide Pure , Potassium Iodo Bismuthate , 1,10-phenanthroline Hydrochloride , 1- Naphtholbenzein Extrapure , Acacia Powder , Acetic Glacial , Acetone , Aluminium Sulphate , Ammonium Thiocyanate Acs , Aniline , Aspirin- Acetylsalicylic , Barium Chloride , Benzoic , Benzoin , Benzyl Chloride , Bromocresol Green Solution , Bromothymol Blue Solution , Calcium Carbonate , Carbon Tetrachloride , Cerium Iii Sulphate , Chloral Hydrate , Chloroform , Cochineal Natural Red 4 , Copper Oxide Black , Phenol Detached Crystals , Diastase -fungal , Dibutyl Phthalate Pure , Edta Disodium Salt Dihydrate Pure , Di-sodium Hydrogen-o-phosphate Anhydrous , Dragendorffs Reagent , Petroleum Ether , Ammonium Ferric Sulphate , Glycerol Monostearate Extra Pure , Grams Iodine , Hydrochloric , Hydroxy Propyl Methyl Cellulose , Iodine Resublimed , Iodine Monochloride Solution , Kaolin Light , Lactose , Lauric Pure , Oil Of Lemon , Liquid Paraffin , Liquid Phenol , Magnesium Sulphate , Methylene Chloride , Microcrystalline Cellulose , Morin Hydrate , N-butanol , Nitro Benzene , Orange Oil , Oxalic , Paraamino Benzoic , Paracetamol Powder , P-chloro M-cresol , 0.1n In Glacial Acetic , Phenol , Phenolphthalein Extrapure Ar , Phenolphthalein Indicator Soln In Ethanol , Phenyl Mercury Acetate For
Supply of Conc. Sulfuric 2.5 Litre , Hydrogen peroxide 500ml , Tartaric 500 gm , Potassium iodide 500 gm , Amyl acetate 500ml , Thiourea 500 gm , Ascorbic 500 gm , Dithiol Solution 1gm , Thioglycolic , solution in water 500ml , Ammonium oxalate monohydrate,500gm , Molybdenum Trioxide, 100 gm , Sodium carbonate anhydrous, 500 gm , Hydrochloric abt. 35pure, 2.5 Lt , Sodium fluoride, 500 gm , Potassium permanganate, 500 gm , Boric , 1 kg , Diluent Ethanol 500ml , Potassium sulphate, 500 gm , Phosphoric , 2.5 Lt , Acetic glacial, 500ml , Calcium carbonate, 500 gm , EDTA disodium salt dihydrate, 500 gm , Murexide, 25 gm , Sodium diethyldithiocarbamate trihydrate, 500 gm , Hydroxylamine hydrochloride, 500 gm , Ammonium chloride, 1kg , Ammonia solution, 2.5L , 2,3,5-Triphenyltetrazolium chloride, 10 gm , 1,3,5-Triphenyltetrazolium formazan 25 gm , Whatman No. 42 , Whatman No.1 Filter paper , Hiclean liquid soap, 5 Lt , Non absorbing cotton , Nitric 69 - 72pure, 5L , Concentrated Analytical grade, 2L , Lanthanum -III chloride heptahydrate, 100 gm , Calcium chloride dihydrate, 500 gm , Methanol, HPLC, 5L , pNitrophenyl phosphate 25 gm , Peptone, 500 gm , Tryptone Glucose Beef Extract Agar, 500 gm , Agar powder, Bacteriological grade, 500 gm , Starch soluble, Hi-AR ACS, 500 gm , Glucose, 500 gm , Casein, 100 gm , Trichloroacetic , 500gm , L-Tyrosine, 25 gm , Manganese -II sulphate monohydrate, 500 gm , Magnesium sulphate heptahydrate, 500gm , Di-potessium hydrogen phosphate, 500 gm , Phenolphthalein indicator, 125ml , Eriochrome black t indicator, 100gm , Lithium chloride -LiCl, 250 gm , Diphenylamine 250gm , Congo red, 25gm , Grams crystal violes, 125ml , Grams iodine, 125ml , Decolorizer 500 ml , Gram safranin 125 ml , Nutrient Agar 500gm , YEMA 500 gm , Pikovskaya broth 500 gm , Simmon Citrate Agar 100 gm , Starch Agar 500 gm , Tryptone Soya Broth 500gm , Urea Agar Base 100gm , MR-VP Broth 100gm , Yeast extract powder 500 gm , Sodium Nitrate 500 gm , Chloroform 2.5L , Potato Dextrose Agar 500 gm , Ferrous Ammonium Sulphate 500 gm , Ethanol 500 ml
Supply of ammonium molybdate tetrahydrate , orthophosphoric abt , sulfuric , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric , , hydrofluoric , phenolphthalein indicator , diethylene triamine penta acetic dtpa , ethelynediamine tetra acetic , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric , calcium chloride , sodium thiosulphate , acetic , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic , murexide , orthophosphoric , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic , citric , oxalic , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric , orthoposphoric , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol
Supply of 1 2 Dichloroethane extrapure 99 percent , 2 3 5 Triiodobenzoic extrapure 98 percent , 2 4 Dinitrophenol 97 percent Indicator , 2 4 Dinitrophenylhydrazine extrapure AR , 3 3 Diaminobenzidine DAB pure 98 percent , 5 5inch Dithiobis 2 Nitro Benzoic extrapure , 5 Sulphosalicylic extrapure 99 percent , Acacia Powder , Acetic Glacial extrapure 99 point5 percent , Acetone pure 99 percent , Fuchsin , Activated Charcoal , Agarose , Albumin Bovine , Ammonia Soln Abt 25 percent Sp Gr 0 point 91 , Ammonium Ferrous Sulphate , Ammonium Molybdate Tetrahydrate , Ammonium Sulphate , Antimony Potassium Tartrate Hemihydrate , Barium Chloride , Bradford Reagent for Proteins , Calcium Chloride Dihydrate extrapure , Calcium Hydrogen Orthophosphate Dihydrate , Calcium Nitrate Tetrahydrate 99 percent , Charcoal Activated 280 extrapure , Chlorocholine Chloride CCC extrapure , Choline chloride extra pure , Cupric Oxide Nanopowder , Dextrose extrapure , Diphenyl amine AR , Dithioerythritol DTE extrapure 99 percent , D Maltose , EDTA Free extrapure 99 percent , Eosin Yellow water soluble , Ethylene di amine tetra acetic Ferric Sodium Salt , Ethylene Glycol pure 98 percent , Evans Blue , Ferric Nitrate Nonahydrate extrapure AR , Ferroin SolnAr , Ferrous Ferric Oxide Nanopowder , Gibberellic GA3 90 percent , Glutathione Oxidized GSSG extrapure , Glycine Betaine Betaine anhydrous , Guaiacol extrapure 99 percent , Hydrochloric 35 38 percent 1 point 18 , Hydrogen Peroxide Soln 20 Volumes 6 percent , Indole 3 Acetic IAA , Iodine Resublimed , Kinetin extrapure , L Tryptophan , L Ascorbic extrapure , Lead II Acetate Trihydrate pure 99 percent , Magnesium Chloride Anhydrous extrapure , Magnesium Sulphate Heptahydrate , Malachite Green Oxalate , Mercuric Iodide Red 99 percent , Mercuric Thiocyanate pure 98 percent , Methanol pure 99 percent , Methyl Orange pH Indicator , Methyl Red Acs Reag , Methyl salicylate , Orange G , Orthophosphoric Abt 85 percent , Paraffin Wax , 60 percent , Phenol Crystalline extrapure AR 99 point 5 percent , Phenolphthalein Soln pH Indicator , Polyethyleneglycol 6000 PEG 6000 , Potassium Chloride , Potassium Dichromate , Potassium Ferricyanide , Potassium Ferrocyanide extrapure , Potassium Hydroxide pellets extrapure , Potassium Iodide pure 99 percent , Potassium Permanganate extrapure 99 percent , Potassium Phosphate Dibasic Anhydrous , Potassium Sulphate extrapure 99 percent , Riboflavin pure 98 percent , Salicylic pure 99 percent , Schiff s Reagent , Selenium Metal Powder , Silicon di oxide nanopowder , Silver Sulphate Purified 98 point5 percent , Sodium Arsenate , Sodium Azideextrapure , Sodium Bicarbonate extrapure , Sodium Chloride extrapure , Sodium Cobaltinitrite , Sodium Fluoride , Sodium Hydrogen Carbonate , Sodium Meta Silicate , Sodium Molybdate Pure 98 102 percent , Sodium Potassium Tartrate Tetrahydrate , Sodium Silicate Meta Nonahydrate , Sodium Sulphate Anhydrous extrapure , Sodium Thiosulphate Pentahydrate , Stannous Chloride , Starch Soluble extrapure , Thiazolyl Blue Tetrazolium Bromide MTT , Thiourea extrapure AR 99 percent , Titanium Dioxide extrapure 98 percent , Toludine blue , Toluene pure 99 percent , Tris Acetate Buffer , Zinc Metal Powder , Zinc Acetate Dihydrate extrapure 98 point5 percent , Zinc Oxide Nanopowder , Petroleum ether , Tris Buffer
