"नये भारत का नया Tender Portal"
Request a call back

Latest Tenders for potassium ferricyanide

Total 53 tenders found
#TBR: 35202733 Closed

Education And Research Institutes

  • Orissa
  • Due On: 12 Sep, 2025 (0 Days Left)

Gem Bids For Chemical, 4 Aminoantipyrine Ampyrone, Ethyl Alcohol, Acetic Acidch3cooh, Acetone, Ammonia Solution Ammoniumhydroxide Concentrated, Ammonium Chloride, Ammoniumferrous Sulphate, Ammonium Metavanadate, Ammoniummolybdate Tetrahydrate, Barium Chloride, Boric Acid, Bromocresol Green Bcg, Calcium Chloride Fused, Carmine, Chloroform, Cobalt Ii Chloride Hexahydrate, Concentratednitric Acid, Copper Ii Sulfate, Curcumin Turmeric Yellow, Dipotassium Hydrogen Ortho Phosphate, Di Sodium Hydrogenphosphate, Disodium Salt Edta, Edta Magnesiumdisodium Complex Edta Mg, Eriochrome Black T, Ethyleneglycol, Ferric Chloride Anhydrous, Ferric Chloridehexahydrate, Ferroin Solution, Formaldehyde Solution, Hydrochloric Acid, Hydroxylamine Hydrochloride, Iodineresublimed, L-glutamic Acid, Magnesium Chloridehexahydrate Extrapure, Magnesium Sulphate Heptahydrate, Mercuric Chloride, Mercuric Sulphate, Methanol, Methylorange, Methyl Red, Murexide Ammonium Purpurate, N 1naphthyl Ethylenediamine Dihydrochloride Neda, N Ndiethyl P Phenylenediamine Sulphate Salt, N Hexane, Orthophosphoric Acid, Phenol, Phenolphthalein Indicator 1percent Soln In Ethanol, Potassium Chloride, Potassiumchromate, Potassium Dichromate, Potassium Dihydrogenphosphate, Potassium Ferricyanide, Potassium Hydrogenpthalate, Potassium Iodate, Potassium Iodide, Potassiumnitrate, Potassium Sulphate, Silica Gel, Silica Gel Blue, Silver Nitrate, Silver Sulphate, Sodium Acetate Anhydrous, Sodium Acetate Trihydrate, Sodium Arsenite, Sodium Azide, Sodium Borohydride Powder, Sodium Carbonate, Sodiumchloride, Sodium Hydroxide Pellets, Sodium Nitroprusside, Sodium Sulphate Anhydrous, Sodium Thiosulphatepentahydrate, Spadns, Starch Soluble, Sulphamic Acid, Sulphanilamide, Sulphuric Acid  /bid Number: Gem/2025/b/6519051* /dated: 22-08-2025  & & / Bid Document1 / 60

3.11 Lacs
View Tender
#TBR: 35148166 Closed

Education And Research Institutes

  • Rajasthan
  • Due On: 04 Sep, 2025 (0 Days Left)

Gem bids for Srl, Potassium Ferricyanide Extrapure Ar 98 Percentage, Potassium Ferrocyanide Extrapure Ar 99 Percentage, Sodium Phosphate Dibasic Anhydrous For Molecular Biology99.5 Percentage, Sodium Phosphate Monobasic Anhydrousfor Molecular Biology 99 Percentage, Potassiumpermaganate Sq 500 G, Formaldehyde 37 41 Percentagewv Sq 500 Ml

Ref. Document
View Tender
#TBR: 34427551 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 15 May, 2025 (0 Days Left)

Gem Bids For 2 4- Dichlorophenoxyacetic Acid , 2 2-diphenyl-1- Picrylhydrazyl , Mitra Medium , Murashige And Skoog Medium , Methanol , Hexane , Chloroform , 2 2-azino-bis 3- Ethylbenzothiazoline-6-sulfonic Acid , Rutin , Chlorogenic Acid , Sodium Phosphate Buffer , Potassium Ferricyanide , Trichloroacetic Acid , 3 5- Dinitrosalicylic Acid Dnsa , Laurylpentachlorphenate Lpca , Formalin

Ref. Document
View Tender
#TBR: 34278450 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 16 Apr, 2025 (0 Days Left)

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

Ref. Document
View Tender
#TBR: 34132819 Closed

Education And Research Institutes

  • Uttar Pradesh
  • Due On: 20 Mar, 2025 (0 Days Left)

Supply of 1 2 Dichloroethane extrapure 99 percent , 2 3 5 Triiodobenzoic Acid extrapure 98 percent , 2 4 Dinitrophenol 97 percent Indicator , 2 4 Dinitrophenylhydrazine extrapure AR , 3 3 Diaminobenzidine DAB pure 98 percent , 5 5inch Dithiobis 2 Nitro Benzoic Acid extrapure , 5 Sulphosalicylic Acid extrapure 99 percent , Acacia Powder , Acetic Acid Glacial extrapure 99 point5 percent , Acetone pure 99 percent , Acid Fuchsin , Activated Charcoal , Agarose , Albumin Bovine , Ammonia Soln Abt 25 percent Sp Gr 0 point 91 , Ammonium Ferrous Sulphate , Ammonium Molybdate Tetrahydrate , Ammonium Sulphate , Antimony Potassium Tartrate Hemihydrate , Barium Chloride , Bradford Reagent for Proteins , Calcium Chloride Dihydrate extrapure , Calcium Hydrogen Orthophosphate Dihydrate , Calcium Nitrate Tetrahydrate 99 percent , Charcoal Activated 280 extrapure , Chlorocholine Chloride CCC extrapure , Choline chloride extra pure , Cupric Oxide Nanopowder , Dextrose extrapure , Diphenyl amine AR , Dithioerythritol DTE extrapure 99 percent , D Maltose , EDTA Free Acid extrapure 99 percent , Eosin Yellow water soluble , Ethylene di amine tetra acetic Acid Ferric Sodium Salt , Ethylene Glycol pure 98 percent , Evans Blue , Ferric Nitrate Nonahydrate extrapure AR , Ferroin SolnAr , Ferrous Ferric Oxide Nanopowder , Gibberellic Acid GA3 90 percent , Glutathione Oxidized GSSG extrapure , Glycine Betaine Betaine anhydrous , Guaiacol extrapure 99 percent , Hydrochloric Acid 35 38 percent 1 point 18 , Hydrogen Peroxide Soln 20 Volumes 6 percent , Indole 3 Acetic Acid IAA , Iodine Resublimed , Kinetin extrapure , L Tryptophan , L Ascorbic Acid extrapure , Lead II Acetate Trihydrate pure 99 percent , Magnesium Chloride Anhydrous extrapure , Magnesium Sulphate Heptahydrate , Malachite Green Oxalate , Mercuric Iodide Red 99 percent , Mercuric Thiocyanate pure 98 percent , Methanol pure 99 percent , Methyl Orange pH Indicator , Methyl Red Acs Reag , Methyl salicylate , Orange G , Orthophosphoric Acid Abt 85 percent , Paraffin Wax , Perchloric Acid 60 percent , Phenol Crystalline extrapure AR 99 point 5 percent , Phenolphthalein Soln pH Indicator , Polyethyleneglycol 6000 PEG 6000 , Potassium Chloride , Potassium Dichromate , Potassium Ferricyanide , Potassium Ferrocyanide extrapure , Potassium Hydroxide pellets extrapure , Potassium Iodide pure 99 percent , Potassium Permanganate extrapure 99 percent , Potassium Phosphate Dibasic Anhydrous , Potassium Sulphate extrapure 99 percent , Riboflavin pure 98 percent , Salicylic Acid pure 99 percent , Schiff s Reagent , Selenium Metal Powder , Silicon di oxide nanopowder , Silver Sulphate Purified 98 point5 percent , Sodium Arsenate , Sodium Azideextrapure , Sodium Bicarbonate extrapure , Sodium Chloride extrapure , Sodium Cobaltinitrite , Sodium Fluoride , Sodium Hydrogen Carbonate , Sodium Meta Silicate , Sodium Molybdate Pure 98 102 percent , Sodium Potassium Tartrate Tetrahydrate , Sodium Silicate Meta Nonahydrate , Sodium Sulphate Anhydrous extrapure , Sodium Thiosulphate Pentahydrate , Stannous Chloride , Starch Soluble extrapure , Thiazolyl Blue Tetrazolium Bromide MTT , Thiourea extrapure AR 99 percent , Titanium Dioxide extrapure 98 percent , Toludine blue , Toluene pure 99 percent , Tris Acetate Buffer , Zinc Metal Powder , Zinc Acetate Dihydrate extrapure 98 point5 percent , Zinc Oxide Nanopowder , Petroleum ether , Tris Buffer

Ref. Document
View Tender
#TBR: 34099580 Closed

Education And Research Institutes

  • Delhi
  • Due On: 14 Mar, 2025 (0 Days Left)

Supply of Ammonium Sulphate GR 500gm , Anthrone AR 100gm , Ammonium Chloride 99 500gm , Ammonium acetate , L Ascorbic Acid AR 100gm , Bromocresol Green 100 gm , Boric acid 5 kg , Citric Acid Monohydrate extrapure 500gm , Calcium carbonate precipitated 500gm , Celite Acid Washed 1kg , Calcium chloride 500gm , Dextrose anhydrous GR 500gm , Folin and ciocalteu s phenol reagent 500ml , Ferric Chloride 500gm , Gallic Acid , Iodine 500gm , Lithium Sulphate Monohydra te extrapure 500gm , Methyl Red 100gm , Magnesium chloride hexahydrate GR 500gm , M Phosphoric Acid 500gm , Phenol carbolic acid 100ml , Potassium Iodide extrapure AR 100gm , Potassium Sulphate AR Grade 500gm , Phosphoric Acid AR grade 500ml , Phosphoric Acid HPLC grade 500ml , Potassium Chloride GR 500gm , Sodium Hydroxide Pellets extrapure , Sodium carbonate monohydrate AR 500gm , Sodium Phosphate Dibasic Dihydrate 500gm , Sodium Phosphate Monobasic Dihydrate extrapure AR 500gm , Sodium Acetate Anhydrous 500gm , Sodium Carbonate Anhydrous 500gm , TPTZ extrapure AR 5gm , Trichloroacetic acid 500gm , DPPH 2 2 Diphe nyl 1 picryl hydrazy 5gm , Methanol AR 2500ml , Acetone AR 2500ml , Sulfuric Acid 2500ml , Nitric Acid 2500 ml , Petroleum Ether 40 60 AR Extra Pure 2500 ml , CHLOROFORM 2500ml , Hydrogen Peroxide , Hydrochloric acid 2500ml , Diethyl Ether 2500ml , Acetonitrile 2500ml HPLC , Dichlorome thane 2500 ml HPLC , Labolene Washing Solution 5litre , Ninhydrin 25g , Nitroblue tetrazolium chloride 1g , Sulphosali cyclic acid 500g , Methanol AR 1000ml , Polyethelyn e glycol 6000 500g , Dinitrosalicylic acid , Sodium potassium tartarate 500g , Starch 500g , KC1O3 Potassium Chlorate 1kg , NaOCl 500 ml , Filter paper Grade no 1 12.5CM p k of 100pcs , Phenol 500gm , Catechol 100gm , Hydroquinon 100gm , P hydroxyb enzaldehyde 100gm , P hydroxyp henylacetal dehyde 100gm , P hydroxybenzoic acid 100gm , Cinnamic acid 250gm , P hydroxyp henylacetic acid 25gm , Protocatec huicacid 100mg , Vanilla acid , Gallic acid 25mg , Caffeic acid 5mg , Ferulic acid 1gm , Syringic acid 25gm , Kaempferol 25mg , Formicacid HPLC 100 ml , Methanol LC grade 2point5L , Ethanol LC grade 2point5 L , Potassium ferricyanide 500gm , FeCl3 500gm , Guaiacol 250gm , Dibasic Potassium Phosphate 500gm , Potassium phosphate monobasic 500gm , Sodium carbonate 500gm , L methionine 100gm , NBT Nitro blue tetrazolium 100mg , Riboflavin 25gm , L Phenylalanine 100gm , Trans cinn amic acid TCA 250gm

Ref. Document
View Tender
#TBR: 34082386 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 11 Mar, 2025 (0 Days Left)

Supply of FCP reagent , Gallic acid , DPPH , Ethanol , Cur Std , CurPCL , Acetone , LiCl , LiNO3 , SBR binder , 1-10 Phen C12H8N2 , Iron trichloride FeCl3 , CoCl2 , Thorin indicator , Lithium hydroxide LiOH.H2O , Potassium periodate KIO4 , Polyvinylidene fluoride binder PVDF , Lithium nitride Li3N , Graphite , Manganese chloride MnCl2 , Nickle chloride NiCl2 , Cobalt nitrate CoNO32 , Manganese nitrate MnN2O6 , Nickle nitrate Ni,NO32 , Methyl acetate , Methyl carbonate , Di-methyl carbonate , Potassium ferricyanide , Neutral red , Disodium anthraquinone-2.6-disulfonate , Platinum oxide , Vitamin K1 Ready Made Solution , TBATFB NBu4BF4 , Sulfuric Acid , NaOH , Boric Acid , Copper or Selenium Catalyst , Methyl red indicator , HCLO4 , NH4 6M07024.4H20 , TARTARIC ACID , Na2SO3 , C8H10K2O15Sb2 , ASCORBIC ACID , H2O2 , N, C, K, NH4 M , F-, Cl-, NO3-, PO4-, SO4-, Br- , Filter paper220nmdi25mm , Syringes 10 ml , Al Heavy duty foil , L.-cysteine , Elec PolKit pk 4 , Arsenic oxide , Chromium chloride , Potassium dichromate , Graphene oxide , Carbon nanotube , Nano diamonds , Carbon nanofibers , C3H5BrClN3 , Glycerol , Ethylene glycol , Diethylene glycol , Triethylene glycol , Ethylene diamine , bi no3 3 5h2o , Na2S-H2O , Citric acid , 5-furouracil , Para-aminophenol , Flutamide , Urea , Thioacetamide , Tetracycline , Metronidazole , Thiophene , Pyrrole , 2 6 ndca

Ref. Document
View Tender
#TBR: 33901023 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 19 Feb, 2025 (0 Days Left)

Supply Of Petroleum Ether 4L, Boric Acid 1000 G, Sodium Chloride 1000 G, Perchloric Acid 70 Percent 500 Ml, Nitric Acid 500 Ml, N Hexane 1500 Ml, Hcl 37 Percent 1500 Ml, Methanol 7000 Ml, Potassium Hydroxide Pellets 200 G, Sodium Sulphate Anhydrous 1L, Ethanol Absolute 99 Point 9 Percent 40 L, Phosphate Buffer Saline 1000 Ml, Standard Vitamins A Or Retinyl Palmitate 200 Mg, Trichloroacetic Acid 500 Mg, Absolute Alcohol 1000 Ml, 2 2 Dipyridyl 200 G, Ferric Chloride Or F2ecl36h20 200 G, Sodium Bicarbonate 500 G, Oxalic Acid 4 Percent 500 Ml, Xylene 1 L, 2 6 Dichlorophenol Indophenol 500 G, Sulphuric Acid 2 L, Thiourea 100 G, Bromine Water 500 Ml, Vitamin C Or Ascorbic Acid Standard 10 G, Vitamin D Standard D2 Ergocalciferol 5 G, Vitamin D Standard D3 Cholecaliferol 10 G, 2 Propanol 200 Ml, Potassium Ferricyanide 250 G, Standard Thiamine Hydrochloride 200 G, Isobutyl Alcohol 300 Ml, Riboflavin Standard 100 G, P2o5 50 G, Sodium Hydrosulphite 50 G, Papain 200 G, Sodium Acetate Buffer 7 500 Ml, Standard Tryptophan 200 G, Chloroform 2500 Ml, High Capacity Cdna Reverse Transcription Kit Cdna Kit 50 Reactions, Dpx 500 Ml, Tris 500 G, Urea 500 G, Red Congo Agar 500 G, Tryptic Soy Agar 500 G, Mrs Agar 500 G, Nutrient Agar 500 G, Casein Hydrolysis Agar 500 G, Christensens Urea Agar 500 G, Starch Hydrolysis Agar 500 G, Tryptophan Peptone Broth 500 G, Mrs Broth 500 G, Phenol Red Carbohydrate Broth 500 G, Nutrient Broth 500 G, Motility Test Medium 500 G, Nitrite And Nitrate Reduction Media 500 G Each, Tryptic Soy Broth 500 G, Pepsin, Tryptophan And Cysteine 50 G Each, Kovacs Oxidase Reagent 20 Ml, Kovacs Indole Reagent 100 Ml, Hydrogen Peroxide 30 Percent 500 Ml, Phenol Red Powder 25 G, Potassium Hydroxide 500 G, Rnase 20 Ml, Proteinase K 20 Ml, Amoxiclav 1 Vial Of 100 Discs, Amoxycillin 1 Vial Of 100 Discs, Streptomycin 1 Vial Of 100 Discs, Erythromycin 1 Vial Of 100 Discs, Vancomycin 1 Vial Of 100 Discs, Tetracycline 1 Vial Of 100 Discs, Chloramphenicol 1 Vial Of 100 Discs, Clindamycin 1 Vial Of 100 Discs, Oxacillin 1 Vial Of 100 Discs, Cephalothin 1 Vial Of 100 Discs, Penicillin G 1 Vial Of 100 Discs, Beef Extract Powder 500 G, Molecular Primer Forward Primer Gm3 5Agagtttgatcmtggc 3 And Reverse Primer Gm4 5Taccttgttacgactt3

Ref. Document
View Tender
#TBR: 33896649 Closed

Education And Research Institutes

  • Nagaland
  • Due On: 20 Feb, 2025 (0 Days Left)

Supply Of Methanol, Sodium Hydroxide, Fehling A, Fehling B, Hydrochloric Acid 0.1N 500Ml, Methylene Blue 125 Ml, Sulphuric Acid 500Ml, Petroleum Ether 500Ml, Folin Ciocalteu Reagent 100Ml, Amino Acid 250 Ml, Humic Acid 500G, Sea Weed Extract 500Ml, Pgpr 1Kg, Vermiwash 1L, Panchagavya 1 L, Jeevamritham 1L, Moringa Leaf Extract 1Kg, Thymic Oil 10Ml, Peppermint Oil 30Ml, Clove Oil 12Ml, Borage Leaf Extarct 100G, Cactus Root Extract 100G, Aluminium Chloride 500G, 1 Percent Potassium Ferricyanide, Ferric Chloride 500G, Phosphate Buffer 100G, Sodium Nitrite, Colchicine, Dpph 250Mg, Ethylmethane Sulphamate, Measuring Cylinder, Conical Flask 100Ml, Burette 25Ml, Pipette 2 Ml, Separating Flask 125Ml, Whatman Filterpaper No. 1, Whatman Filterpaper No. 42, Mortar Pestle, Muslin Cloth, Vernier Calliper Manual, Microcentrifuge, Water Bath, Top Pan Balance, Secatur Falcon, Budding Knife, Khuripi, Watering Can Round, Coconut Rope Roll, Trimmur Line Roll, Hand Gloves Vns Size 10 Ce Pair, Reti Big Size, Wheel Barrow, Seed Tray, Sprayer Foots, Nursary Poly Bags In Kg, Urea 50Kg, Dap, Mop, Ssp, Rogor 200Ml, Tricel 100Ml, Bavistin 100G, Blitox, Hijack 1L, Chloropyriphos 1 Kg, Cocopeat Blooks, Rose Water Can, Sintax Water Tank, Parafilm, Phenol Red, Sodium Thiosulphate, Screw Capped Test Tube Glass, Bromothymol Blue, Ttc, Thymol Crystals, Bromine Water, Trichloroacetic Acid, Casein Hydrolysate, Non Absorbent Cotton, Calcium Phosphate, Orthophosphoric Acid, Nesslers Reagent, Picric Acid, Pikovskaya Agar, Pseudomonas Isolation Agar, Eosin Methylene Blue Agar, Micropipette Tips Packets, Latex Gloves, Azomithine H 1L, Dtpa 100G, Calcium Chloride Dihydrate 100G, Iba 5G, Naa 5G

5.00 Lacs
View Tender
#TBR: 33702170 Closed

Education And Research Institutes

  • Madhya Pradesh
  • Due On: 20 Jan, 2025 (0 Days Left)

Supply Of Forex Sheet 8 X 4, Yoga Mat, Music Octopad, Stop Watch, Vernier Callipers, Law Of Prallelogram Apparatus, Sonometer, Searls Apparatus, Resonance Opparator, Meter Bridge, Compound Microscope, Ammonium Carbonate, Ammonium Chloride, Ammonium Sulphate, Ammonium Nitrate, Aluminium Chloride, Aluminium Sulphate, Barium Chloride, Barium Nitrate, Calcium Carbonate, Copper Chloride, Magnesium Sulphate, Lead Acetate, Lead Nitrate, Ferrous Sulphate, Cadmium Carbonate, Sodium Hydroxide Pellet, Hydrochloric Acid, Sulphuric Acid, Glacial Acetic Acid, Ethanol, Acetone, Sodium Nitroprusside, Potassium Permangnate, Potassium Dichromate, Potassium Ferrocyanide, Potassium Ferricyanide, Potassium Iodide, A4 Size Colour Papers, Acrolic Colour, Colour- White, , Colour- Green, Colouryellow, Colour- Black, Colour- Red, Colour- Brown, Thunmb Pins, A4 Size Paper Rim, Silver, , , , , , , , Paper A4 Size, Scissors, Hand Made Paper Yellow, Hand Made Paper Red, Hand Made Paper Disigner, Taper Roll Red, Taper Roll Blue, Taper Roll Golden, Transparent Packing Wrap Roll, Transparent Tap, Double Sided Tap, Tray Plastic, Catridge Paper, Art Paper Glossy, Pastel Paper Blue, Pastel Paper Red, Pastel Paper Orange, Pastel Paper Black, Card Board, Chisel Red, Chisel Bule, Round Brush 2, 6, 8, Camel Poster Colour, Brown Tape, Cello Tape, Stapler Pin, Electric Rip, Electric Wiring, Bombay Kil, Brown Sheet, Marker Pen Rbb Set Temprory, Marker Pen Rbb Set Permanent, Football 5, Football 4, Cricet Bat L Size, Cricet Bat M Size, Football Net, Handball Net, Basket Ball Net, Badminton Net, Flex 3 X 4, Helogen, Hose Pipe Bundle, Seeds Pack, Fertilizer Bag, Dustbin, Water Centralise Ro System, Gloves, Mask, Dustbin Bag, Phenyle Liter, Make Up Kit, Big Cement Pot, Book, Badge, Collar Mike, 90Gsm Rim 500 Sheet

Ref. Document
View Tender
Download Document