"नये भारत का नया Tender Portal"
Request a call back

Latest Tenders for pyrogallol

Total 35 tenders found
#TBR: 35025393 Live

Education And Research Institutes

  • Bihar
  • Due On: 23 Aug, 2025 (15 Days Left)

Gem Bids For Physical, Fume Hood Complete Setup Rotavapor Setup Ionexchange Setup Double Stage Laboratory Vacuum Pump Glass Receiver Flask 1000 Ml Silicone Stopper Pack Of 10 Buchner Funnel With Sintered Disc Buchner Funnel Digital Ultrasonic Sonicator Bath Digital Ph Meterbenchtop Water Distillation Unit Silicon Rubber Tubing10m Hotplate And Stirrer With Digital Display Precisionbalances Uv Lamp Chamber Melting Point Apparatus Universal Lab Centrifuge Centrifuge Tubes 15 Ml Digitalpotentiometer Complete Setup Electric Circulating Waterbath 20l Vaccum Desiccator All Clear Pc-pc 250 Mm Vacuum Desiccator All Clear Pc-pc 150 Mm Vacuumdesiccator All Clear Pc-pc 300 Mm Perforatedpolypropylene Disc For Desiccator 150 Mm Perforatedpolypropylene Disc For Desiccator 250 Mm Perforatedpolypropylene Disc For Desiccator 300 Mm Laboratoryoven With Digital Display Ethanol Distillation Glassassembly 1000 Ml Separating Funnel Pear Shaped 500ml Straight Joint Retort Ring For Separating Funnel Rotaryevaporator Flask With I-c Joint 1000 Ml 29-32 Rotaryevaporator Flask With I-c Joint 500 Ml 29-32 Rotaryevaporator Flask With I-c Joint 500 Ml 24-29 Rotaryevaporator Flask With I-c Joint 250 Ml 24-29 Adaptorbent Cone With Stopcock 24-29 Enlarging Connectingadaptors 29-32 24-29 Glass Splash Head Rotavaporadaptor 29-32 24-29 Round Bottom Flask Short Neck 24-29 100 Ml Round Bottom Flask Short Neck 24-29 250ml Round Bottom Flask Short Neck 24-29 500 Ml Round Bottom Flask 2-necked 250 Ml Flask Flat Bottom24-29 250 Ml Flask Flat Bottom 24-29 500 Ml Flaskstand For Round Bottom Flask Liebig Reflux Condenser300 Mm 24-29 Stalganometer Straight Graduated Ostwald Viscometer Screw Pinch Cock For Stalganometer Bid Number Gem2025b6497130 Dated 02-08-2025 Bid Document1 111 0 0 Stand Base And Rod, Retort Stand, , Burette, 50 Ml, , Pippete, 10 Ml, , Capillary, 0.30 Mm Od, , Melting Pointtube, 0.5 Mm, , Measuring Flask With Glass Stopper, 100 Ml,, Erlenmeyer Flask, 250 Ml, With Socket B-24, Glassstopper B-24, Hollow, Hexagonal, , Chromatography Column, Test-tubes, 15 Ml, Pack Of 100, Test-tube Stand, Plastic,, Test-tube Holder, Wash Bottle, 500 Ml, Ldpe, Funnel, 100 Mm, , Funnel, 50 Mm, , Plastic Beakers, 500 Ml, , Plastic Beakers, 1000 Ml, , Beakers, 100 Ml, , Beakers, 1000 Ml, , Conical Flask, 100 Ml, , Spatula Big, 12 Inches, , Spatula, 6 Inches, , Forceps, Steel, 6 Inches, , Filter Papercircle Packet, Rough Filter Paper, 500 Sheets, , Magneticbid, Thermometer, Aspiratory Bottle With Stop Cock, 5000ml, Aspiratory Bottle With Stop Cock, 10000 Ml, Dropper, Glass, 15 Cm With Rubber Teat, Dropping Bottles Withglass Dropper And Silicone Teat, 60 Ml, Droppingbottles With Glass Dropper And Silicone Teat, 125 Ml, Dropping Bottles With Glass Dropper And Silicone Teat, Amber, 60 Ml, Reagent Bottles Narrow Mouth Withscrew Cap, 100 Ml, Reagent Bottles Narrow Mouth Withscrew Cap, 250 Ml, Reagent Bottles Narrow Mouth Withscrew Cap, 500 Ml, Drying Tube 24-29, Nitrile Gloves, Test Tube Brush, Nylon, , Burette Brush, Nylon, , Bottlebrush, Nylon, , Tong For Holding Beaker, 12 Inches, , Tlcplates Silica Gel 60 Matrix, Aluminium Sheet, , Pk Of 25sheets, , Rubber Pipe, 50 Meter, , Surgical Mask Packet, Laboratory Tissue Paper Roll, 190 Pulls 10 Roll, , Ethyleneglycol, Lr, 2.5l, Iso-propyl Alcohol, Lr, 2.5 L, Ethyleneglycol, Ar, 2.5 L, N-hexane, 2.5 L, Chloroform, 2.5 L, Ethylacetate, 2.5 L, Methanol, 2.5 L, Acetone, 2.5 L, Hydrochloric Acid, Conc.,, 2.5 L, Sulphuric Acid, Conc.,, 2.5 L, Nitric Acid, Conc.,, 2.5 L, Glacial Acetic Acid, 2.5 L, Acetylchloride, 500 Ml, Aniline, 500 Ml, Ammonia Water, 2.5 L, Phenolphthalein, 100 G, Eriochrome-black T Powder, 25 G, Methyl Orange, 25 G, Oxalic Acid, 500 G, 1- Naphthol, 100 G, 2-naphthol, 500 G, P-nitrophenol, 250 G, P-nitroaniline, 100 G, Naphthalene, 500 G, Picric Acid, 100 G, Resorcinol, 250 G, Catechol, 250 G, Succinic Acid, 500 G, Cinnamicacid, 250 G, Phthalic Acid, 500 G, Salicylic Acid, 500 G, Pyrogallol, 100 G, D-glucose, 500 G, Sucrose, 500 G, Acetophenone, 500 Ml, Sodium Nitroprusside, 100 G, Methyl Salicylate, 500 Ml, Ammonium Cerric Nitrate, 100 G, Toluene, 500 Ml, Copper Sulphate, 500 G, Diphenylamine, 100 G, Phenol, 500 G, Nitrobenzene, 500ml, Ferric Chloride Anhydrous, 500 G, Zinc Chloride, 500 G, Sodium Metal, 250 G, Potassium Sodium Tartarate, 500 G, 2, 4-dinitrophenyl Hydrazine, 25 G, Pure Bromine, 100 Ml, Benzaldehyde, 500 Ml, Formaldehyde, 500 Ml, Disodiumedta Salt, 500 G, Calcium Carbonate Anhydrous, 500 G, Sodium Bicarbonate, 500 G, Sodium Hydroxide Pellets, 500g, Ammonium Chloride, 500 G, Phthalic Anhydride, 500 G, Sodium Nitrite, 500 G, Silica Gel 60-120 Mesh, 500 G, Charcoal, 500 G, Potassium Permanganate, 500 G, Potassium Dichromate, 500 G, Ammonium Ferrous Sulphatear, 500 G, Silver Nitrate Ar, 25 G, Silver Chloride Ar, 25 G, Calcium Chloride Fused, 500 G, Diethyl Ether, 500 Ml, Paraffin Liquid Heavy, 2.5 L, Neutral Cleaning Solution, 5 L, Silicone Vacuum Grease, 50 G, Iodine, 100 G, Litmus Blueindicator Paper Strips Pkt, 10 Bks, Litmus Red Indicatorpaper Strips Pkt, 10 Bks, Galvanometer, Oscilloscope100mhz, Dc Power Supply, Magnet, Franck-hertzexperiment Apparatus, Four Probe Method Apparatus, Ammeter, Voltmeter, Resistance Box, 1-500 Ohm, , Resistance Box, 1-5000 Ohm, , Dielectric Constant Meter,     //bid Details2 / 111 Newton-s Ring Apparatus, Travelling Microscope, Spectrometer, Plano-convex Lens, Lens Holder, Deflectionmagnetometer, Vibration Magnetometer, Stop Watch, Spirit Level, Digital Vernier Callipers, Physical Balance, He-ne Laser Source, Setup, , Meter Scale

Ref. Document
View Tender
#TBR: 34394119 Closed

Security Services

  • Madhya Pradesh
  • Due On: 01 May, 2025 (0 Days Left)

Gem Bids For 406 Pyrogallol-

Ref. Document
View Tender
#TBR: 34396771 Closed

Power

  • Rajasthan
  • Due On: 10 May, 2025 (0 Days Left)

Gem Bids For Dimethyl glyoxime Grade AR GR Purity minimum 99 PERCENT Packing Size 0.5L Packing Type Glass Bottle Dimethyl Sulphate Grade AR GR Purity minimum 99PERCENT Packing Size 0.5L Packing Type Glass Bottle Mono Ethanol amine Grade Extra pure HPLC Packing Size 0.5L Packing Type Glass Bottle Lithium chloride Grade AR GR Packing Size 500 gm Packing Type plastic Bottle Glycerol Grade AR GR Purity 86-88 PERCENT Packing Size 500ml Packing Type Glass Bottle D-Sorbitol Grade AR GR Purity minimum 99PERCENT Packing Size 500g Packing Type plastic Bottle Potassium Per Sulphate Grade AR GR Purity minimum 99PERCENT Packing Size 500g Packing Type plastic Bottle Pyrogallol Grade AR GR Purity minimum 98PERCENT Packing Size 100g Packing Type Glass Bottle 1,2-Naphthaquinone-4-Sulphonic acid Grade AR GR Purity minimum 97PERCENT Packing Size 10g Packing Type plastic Bottle

Ref. Document
View Tender
#TBR: 34278450 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 16 Apr, 2025 (0 Days Left)

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

Ref. Document
View Tender
#TBR: 34134594 Closed

Education And Research Institutes

  • Uttar Pradesh
  • Due On: 21 Mar, 2025 (0 Days Left)

Supply of Sodium sulphate AR , Potato dextrose broth AR , Tween 80 AR , EtBr MB , Polyethylene glycol 6000 AR , Peptone AR , Sodium Chloride AR , EDTA AR , NitroblueTetrazolum Chloride NBT AR , Ninhydrin AR , Di aminobenzidine AR , Schiff fusion Sulphite reagent AR , HPLC Grade water , Methanol HPLC grade , 1 napthyl ethylenediamine dihydro chloride NEDD , Potassium Chloride AR , Evans blue AR , Chloroform MB , Folin reagent , DEPC , Barium Sulphate AR , Manganese Sulphate AR , Zinc Metal Powder AR , Citric acid powder AR , Sulphanilic acid AR , 1 napthylamine AR , Magnesium Oxide AR , Potassium Nitrate AR , Xylose AR , Sodium dodocyl sulphate MB , Pyrogallol AR , Veratry alcohol AR , Guaiacol AR , Azure B AR , Calcium Chloride AR , Chelex 100 sodium form , 3 point 5 dintroslicylic acid AR , Sodium metasulphite AR , Sodium acetate AR , Dithiothreiol DTT AR , Sodium potassium tartarate AR , Malic acid AR , Phenopthelin AR , Sodium azide AR , Glycerol AR , Sodium hydrogen carbonate AR , L serine AR , Isopropanol AR , Malachite green AR , Remzol brilliant blue AR , Aluminium Chloride AR , Beef extract AR , Tri calcium phosphate , Vanadium chloride AR , Potassium sulphite AR , Ethanol AR , DAPI stain , bisBenzimide , SYBR Green Quantitative RT qPCR Kit QR0100 , Conical flask 50ml , Conical flask 100ml , Conical flask 150ml , Conical flask 250ml , Conical flask 500ml , Petri plates 100 x 17mm , Microscope cover glass , Quartz boiler 5 lit , Plastic pots 30cm dia x 30 cm height , Plastic pots 15cm dia x 15cm height , Dessicator Vacuum pump

Ref. Document
View Tender
#TBR: 34105669 Closed

Chemicals

  • Kerala
  • Due On: 07 Mar, 2025 (0 Days Left)

Supply of AMMONIUM CHLORIDE , ACETONITRILE , BARIUM CHLORIDE , CALCIUM CHLORIDE , CHLOROFORM , DISODIUM HYDROGEN PHOSPHATE , POTASSIUM DIHYDROGEN PHOSPHATE , KARL FISCHER REAGENT , METHANOL , BUFFER TABLET , POTASSIUM BROMIDE , POTASSIUM HYDROGEN PHTHALATE , PYROGALLOL , PETROLEUM ETHER , POTASSIUM THIOCYANATE , POTASSIUM DICHROMATE , SODIUM AZIDE , SODIUM SILICATE , STARCH , SODIUM HYDROXIDE PELLETS , SODIUM CHLORIDE , ACETIC ACID GLACIAL , HYDROCHLORIC ACID , NITRIC ACID , FERRIC CHLORIDE HEXA HYDRATE , SODIUM META BISULPHITE , STANNOUS CHLORIDE , THIO GLYCOLLIC ACID , ORTHO PHOSPHORIC ACID , PHENYL HYDRAZINE , n BUTYL ALCOHOL , ZINC SULPHATE , ALIZARIN RED S , UNIVERSAL INDICATOR SOLUTION

Ref. Document
View Tender
#TBR: 33995498 Closed

Education And Research Institutes

  • Bihar
  • Due On: 03 Mar, 2025 (0 Days Left)

Supply of C2 Propanol isopropanol 1 lit , Sodium Hydroxide 1 kg , Sodium dodecyl sulfate SDS 500 gm , Trisbase 500 gm , Glacial Acidic Acid 500 ml , Ethidium Bromide 10 ml , Diethyl pyrocarbonate DEPC H2O 100 ml , Ethanol 99 point 9 percent 1 lit , Folin Ciocalteau reagent FCR 500 ml , Sodium carbonate anhydrous Hi AR Na2CO3 500 gm , Catechol 500 gm , D minus plus Glucose monohydrate Hi AR 500 gm , D minus plus Glucose anhydrous 1 kg , Alpha Nepthol Reagent 1 kg , Sulfuric acid H2SO4 2 point 5 lit , Agrose Powder 500 gm , 50X TAE Tris acetate EDTA 500 ml , Tris Hydrochloric acid HCL 500 gm , Polyvinylpyrrolidone PVP 500 gm , sodium carbonate Na2CO3 500 gm , Potassium dihydrogen phosphate anhydrous KH PO 500 gm , Potassium hydroxide pellets 500 gm , Potassium phosphate dibasic anhydrous K HPO 500 gm , sodium hydroxide NaOH 500 gm , copper sulphate CuSO4 point 5H2O 500 gm , potassium sodium tartarate 500 gm , Bovine albumin fraction BSA 100 mg , Acrylamide 500 ml , Bis Acrylamide 500 ml , Bromophenol blue 25 gm , Ammonium persulfate APS 1 kg , N N N N tetramethyl ethylene diamine TEMED 100 ml , Methanol 99 point 8 prencatege 500 ml , Acetic Acid 500 ml , Beta Mercapto ethanol 250 ml , Cetyl trimethly ammonium brom ide CTAB 500 gm , Phenol Solution Equilibrated with 10 mM TrisHCl pH 8 point 0 with 1 mM EDTA 500 gm , Isoamyl 500 gm , Trizol Reagent 100 ml , Sodium acetate anhydrous 500 gm , Chloroform 500 gm , Phenol Chloroform Isoamyl alcohol mixture 500 gm , Dimethyl sulfoxide DMSO 250 ml , Acetone 2 point 5 lit , Potassium phosphate dibasic anhydrous K2HPO4 500 gm , Potassium phosphate monobasic anhydrous KH2PO4 500 gm , Methionine 100 gm , Riboflavin 100 gm , 1 M Ethylene diamine tetra acetic acid EDTA pH 8 point 0 100 gm , Nitroblue tetrazolium NBT 250 mg , Hydrogen peroxide H2O2 500 ml , 5 Sulphosalicylic acid dihydrate 1000 gm , Ninhydrin 25 mg , Phosphoric acid 250 ml , Toluene 2 point 5 lit , L Amino acids kit 1 kt , Thiobarbituricacid TBA 100 gm , Trichloroacetic acid 500 gm , Tricarboxylic acid TCA 25 gm , Sodium hydroxide NaOH 500 gm , Hydrochloric acid HCl 2 point 5 lit , 3 5 Dinitrosalicylic acid DNS Reagent 100 gm , Methanol HPLC 2 point 5 lit , 2 2 diphenyl 1 picrylhydrazil dpph 1gm , Gallic acid 500 gm , Anthrone Reagent 100 gm , n Hexene 2500 ml , Perchloric Acid 500 ml , Glycerol 1 lit , Glycine 100 gm , Sucrose 500 gm , Glucose oxidase kit 1kit , B Nicotinamide adenine dinucleotide NADH 500 mg , 2 6 Dichlorophenol Indophenol DCIP 25 gm , Thiazolyl Blue Tetrazolium Bromide MTT 5 gm , Pyrogallol 500 gm , Linoleic acide 25 ml , Nicotinamide adenine Dinucleotide NAD plus 5 gm , Malate 100 gm , Nicotinamide adenine dinucleotide phosphate disodium salt NADP plus 1 gm , L Proline 25 gm , Oxaloacetic acid 25 gm , Ammonium sulfate 500gm , 5 5 Dithiobis 2 Nitro Benzoic Acid DTNB 10 gm , Magnesium chloride MgCl2 AR 500 gm , Acetyle CoA 10 gm , Boric acid H3BO3 500 gm , linseed oil 1lit , potassium sodium tartrate 500 gm , Copper II sulfate pentahydrate 100 gm , L Malic acid 50 gm , Ascorbic acid 25gm , Lecithin granules 250gm , Cellulose 500gm , Brewers yeast 150gm , myo inositol 25gm , choline chloride 500gm , flaxseed oil 1lit , phytagel 100gm , Vitamin fortification mixture for insects 100gm

Ref. Document
View Tender
#TBR: 33378066 Closed

Security Services

  • Himachal Pradesh
  • Due On: 10 Dec, 2024 (0 Days Left)

Supply Of Lv1-R72 4720720261760 Pipe Line Assy - Relay Frame Assy., Mcc Frame Assy., D.P.Latch Frame Assy 203Bs43 Bhel, Classroom Chairs, Carbon Steel Coated Line Pipes, Line Tester, Line Interactive Ups With Avr V2, Seamless Line Pipe As Per Api 5L / Iso 3183 Oil Psu, Portable Voice Recorder, Bulk Packing Of Tsm Assy Bsf, Rescue Line Launcher, Cross - Over Pipe For Line Pipe Casing Pipe Petroleum Industry, Lv1-R72 Tu005-6016-87-2T25-15 Hose 25X13mm - Pyrogallol, Classroom Chairs, Eosin Y Dissodium Salt, Sterile Hypodermic Needles For Single Use V2, Ammonium Carbonate, Sofa Set Steel Tube, Acid Slurry Or Alkyl Benzene Sulphonic Acid As Per Is 8401, Signal/ Triad Cable, Inositol, P - Nitrophenyl - B - D - Glucopyranoside, Lv1-R72 5330720114854 Ring Packing -175-51-017-1 - Packing Strip, Wooden Packing Cases, Hand Cleaner Soap As Per Is 2888, Graphite Gland Packing Ropes, Mobile Containers For Solid Waste Industrial - Is 12402, Eto Packing Paper Roll, Ring Binder - File Folder, Packing List Envelope V2, Muffle Furnace, Bulk Packing Of Tsm Assy Bsf, Lv1-R72 175-52-056 Ring Packing - Oil Om-52-Defence, Packing Strip, Non Sparking Ring Slugging Spanners V2, Benzaldehyde, Mobile Containers For Solid Waste Industrial - Is 12402, Wooden Packing Cases, Speed Post Stickers, Bacillus Thuringiensis Var. Kurstaki Serotype H-3A, 3B, Strainz-52, Ring Binder - File Folder, Graphite Gland Packing Ropes

Ref. Document
View Tender
#TBR: 33366513 Closed

Security Services

  • Himachal Pradesh
  • Due On: 10 Dec, 2024 (0 Days Left)

Supply Of Lv1-R72 4720720261760 Pipe Line Assy - Relay Frame Assy., Mcc Frame Assy., D.P.Latch Frame Assy 203Bs43 Bhel, Classroom Chairs, Carbon Steel Coated Line Pipes, Line Tester, Line Interactive Ups With Avr V2, Seamless Line Pipe As Per Api 5L / Iso 3183 Oil Psu, Portable Voice Recorder, Bulk Packing Of Tsm Assy Bsf, Rescue Line Launcher, Cross - Over Pipe For Line Pipe Casing Pipe Petroleum Industry, Lv1-R72 Tu005-6016-87-2T25-15 Hose 25X13mm - Pyrogallol, Classroom Chairs, Eosin Y Dissodium Salt, Sterile Hypodermic Needles For Single Use V2, Ammonium Carbonate, Sofa Set Steel Tube, Acid Slurry Or Alkyl Benzene Sulphonic Acid As Per Is 8401, Signal/ Triad Cable, Inositol, P - Nitrophenyl - B - D - Glucopyranoside, Lv1-R72 5330720114854 Ring Packing -175-51-017-1 - Packing Strip, Wooden Packing Cases, Hand Cleaner Soap As Per Is 2888, Graphite Gland Packing Ropes, Mobile Containers For Solid Waste Industrial - Is 12402, Eto Packing Paper Roll, Ring Binder - File Folder, Packing List Envelope V2, Muffle Furnace, Bulk Packing Of Tsm Assy Bsf

Ref. Document
View Tender
#TBR: 32189880 Closed

Education And Research Institutes

  • Sikkim
  • Due On: 25 Jul, 2024 (0 Days Left)

Supply Of Chemicals Horticulture 1 Chloro 2 4 Dinitrobenzene, Alpha Amylase From Malt, 2 3 5 Triphenyl Tetrazolium Salt, 2 Methoxy Ethanol, 8 Hydroxyquinoline, Acetic Acid Glacial, Acetone Hi Ar, Acetonitrile Hplc, Activated Charcoal Granular Powder, Agarose, Aluminium Sulphate Purified, Antimony Potassium Tartarate, Aspartic Acid, Beta Mercaptoethanol Merceptoethanol, Borax, Boric Acid Gr Pure, Butylated Hydroxytoluene, Chlorogenic Acid, Potassium Hydrogen L Tartarate, Ctab Cetyltrimethylammonium Bromide, Dinitrosalicylic Acid, Edta Ferric Monosodium Salt, Ferrous Ammonium Sulphate, Gentamycin, Glutamic Acid Lglutamic Acid, Green Master Mix, Guanidine Thiocyanate, Lead Four Acetate, Methanol Hplc Grade, Mphosphoric Acid Sticks, Naphthalene Acetic Acid, Pectin Pure, Petroleum Ether, Potassium Chloride Gr Purified, Potassium Dichromate, Potassium Sodium Tartarate Tetrahydrate, Dipotassium Sulphate, Dna Ladder 100Bp, Sodium Hydroxide Naoh, Streptomycin Sulphate, Streptomycin, Sulphuric Acid H2so4, Trizol, Tertiary Butyl Alcohol, Thiourea, Toluene, Benzoyl Chloride, Triethylamine Hplc Grade, Sodium Bisulftein, Tris Hcl, Zinc Sulphate Heptahydrate Gr, 50X Tae Buffer, Bromine Water, Pyrogallol, 1 3 5 Triphenyl Tetrazolium Formazan, Catalase From Bovine Liver, Guaicol Hi Lr, Edta Powder For Molecular Biology, Orcein, 10X Te Buffer, Dnase I Solution, Rnase A Solution, Nuclease Free Water, Astilbin

Ref. Document
View Tender
Download Document