"नये भारत का नया Tender Portal"
Request a call back

Latest Tenders for pyrogallol

Total 39 tenders found
#TBR: 36212123 Closed

Education And Research Institutes

  • Haryana
  • Due On: 13 Jan, 2026 (0 Days Left)

Gem Bids For Consumabale, Solvent, Biochemical, Plasticware, Glassware, Reagentacetonitrile, Hplc, 1, 10-Phenanthroline Monohydrate, 1-Butanol, 1-Propanol, 2, 2 - Diphenyl-2-Picrylhydrazylindpph, 2, 2-Azino-Bis3-Ethylbenzothiazoline-6-Sulfonicacid, 2, 4, 6-Tripyridyl-S-Triazine, 2-Mercaptoethanol, Absolute Ethanol China, 99.99%, Acetic Acid, Acetone, Amicon Ultra Centrifugal Filter, 30 Kda Mwco, Calciumsulphate, Dihydrate, Chloroform, Dialysis Membrane-50, Dimethyl Sulphoxide Dmso, Ferric Chloride Anhydrous, Folin & Ciocalteus Phenol Reagent, Formaldehyde Sol 37 -41%, Formic Acid,, Glacial Acetic Acid, Glycerol, Glycine, Mayers Reagent, Methanol, Micro Tip Box, 1Ml, Micro Tip Box, 20-200Ul, Microcentifuge Tube, 1.5Ml, Microcentifuge Tube, 2Ml, Naringin, N-Hexane, N-Propyl Gallate, Phenylmethylsulfony Flouride Pmsf, Pipette Tips, 1000Ul, Potassium Chloride, Potassium Iodide, Pyrogallol, Silica Gelg, Sodium Acetate Trihydrate, Sodium Azide, Sodium Citratedihydrate, Sodium Hydroxide Pellets Sq 500G, Sulfuric Acid, Tannase From Aspergillus Ficuum, Temed, Test Tubes Widemouth With Rim 25*100, Tlc Aluminium Sheets Withfloroscence Indicator F254, Tlc Sheets, Vanillin, Hi-Ar, Wagners Reagent, Yeast Extract Powder, Ascorbic Acid, Quercetin, Caffeine, Palmitic Acid, Pvp, Sodium Borohydride, Chlorpyrifos 99.94%, Sodium Triphosphate, Uv-Quartzglass Cuvette, 10Mm Path Length, 1Ml, 2 Methyl Propanol/Isobutanol Extrapure Ar, 99.5%, Acetone Extrapure, 99%, Agar Powder, Bacteriological Grade, Ammonium Acetateextrapure Ar, 98%, Ammonium Chloride Acs, 99.5%, Ammonium Sulphate Acs, 99.5%, Hm Extract Powder Meatextract Powder Beef, Bhi Agar, Bradford Reagent Forproteins, Buffer Capsules Ph 7.00 0.05, Buffer Capsules Ph9.20 0.05, Buffer Capsules Ph 7.00 0.05, Calcium Carbonate  /Bid Number: Gem/2025/B/7019477* /Dated: 23-12-2025  & & / Bid Document1 / 123

Ref. Document
View Tender
#TBR: 35691324 Closed

Education And Research Institutes

  • Jammu And Kashmir
  • Due On: 06 Nov, 2025 (0 Days Left)

Gem Bids For Lithium, Carbon Disulide, Tin Ii Ethylhexanoate, Pyrogallol, Glutaricacid, Aluminium Chloride, Thiourea Sd, Dimethylaminopyridine, Zinc Sterate, Zinc Nitrate Hexahydrate, O Vanillin, Bis Pinacolato Diboron, Bisdiphenylphosphino Ferrocene, Benzenedimethanol, Adamantanedicarboxylic Acid, Lithiumbis Trifluoromethanesulfonyl Imi, Diglycolic Acid, Zinc Iodide, Benzyl Alcohal, Nitrobenzoic Acid, Bromobutanoyl, Ethylacetate Sa, Dmso, Diethyl Ether, Magnisium Sulphate, Sodium Sulfate, Thf, Aq Ammonium, Isopropyl Alcohol, Potassium Aceterate, Eugenol, Selenium Powder, Cesiumcarbonate, Nitric Acid, Sulphuric Acid, Thionyl Chloride, Silicon Oil, Hydrogen Peroxide, Sodium Chloride, Sodiumhydroxide, Hexane, Acetonitrile, Ethanol, Methanol, Dichloromthane

Ref. Document
View Tender
#TBR: 35610475 Closed

Education And Research Institutes

  • Uttaranchal
  • Due On: 03 Nov, 2025 (0 Days Left)

Custom Dna Synthesis Of Primers 25 Nmol , Prime Script 1st Strand Cdna Synthesis Kit 50 Reactions , Tb Green Pre Mix Ex Taq Ii Tli Rnase H Plus , Rnaiso Plus Total Rna Extraction Reagent , Amylase From Bacillus Licheniforms , Amyloglucosidase From Aspergillus Niger Lyophilized Powder 70 U Mg , Glucose Oxidase Form Aspergillus Niger Type Vii Lyophilized Powder 100000 Units G Solid Without Added Oxygen , Peroxidase From Horseradish Type Ii Essentially Salt Free Lyophilized Powder 150 250 Units Mg Solid Using Pyrogallol , Primers Forward Revers Total Base 1249 , Fish Immunoglobulin M Ig Elisa Kit 96t , Superoxide Dismutase Sod Elisa Kit , Fish Lysozyme Renal Amyloidosis Lzm Elisa Kit , Fish Interleukin 6 Il 6 Elisa Kit , Fish Cortisol Elisa Kit , Forward Primers , Reverse Primer , Taq Dna Polymerase , Ezassay Antioxidant Activity Estimation Kit Cuprac 200 Tests , Azo M Protein Azo Casein , Ezdetect Pcr Kit For Mycoplasma Detection Based On 16s 23s Rrna Spacer Region , Trypsin Inhibitor Powder Source Soyabean Cell Culture Tested Activity 7000baee Units Of Inhibition Mg , Coif1 5tcaaccaaccacaagacattggcac3 26 Nucleotides , Coir1 5tagacttctgggtgccaaagaatca3 26 Nucleotides , M151 5aacccggctttcggcagca3 20 Nucleotides , M152 5cggggcggggttgtgagat3 20 Nucleotides , Ihn Up F 5agagatccctacaccagagac 3 21 Nucleotides , Ihn Up R 5agagatccctacacagagac 3 21 Nucleotides , Vn F 5atggaaggaggaatcgtgaagcg 3 24 Nucleotides , Vn R 5

16.98 Lacs
View Tender
#TBR: 35607614 Closed

Education And Research Institutes

  • Uttar Pradesh
  • Due On: 03 Nov, 2025 (0 Days Left)

Gem Bids For L Methionine, Phosphate Buffer, Edta, H2 O2, Boratebuffer, L Phenylalanine, Tri Chloro Acetic Acid, Hydrochloric Acid, 2 Mercaptoethanol, 1m Sodium Bufferphosphate, Pyrogallol, Nitro Blue Tetrazolium Nbt Chloride, Pvp, Riboflavin, Guaiacol, Triton X, Tris Hcl Buffer, Potato Dextrose Agar, Nutrient Agar, Di Sodium Hydrogenphosphate, Sodium Di Hydrogen Phosphate, Potassiumhydroxide, Sodium Hypochlorite, Lactophenol Cotton Blue, Maxima Sybr Green Rox Qpcr Master Mix 2x, Revert Aidfirst Strand Cdna Synthesis Kit, Oat Meal Agar, Streptomycin, Permanent Marker Black, Permanentmarker Red, Micro Tube Racks 20 X 2ml, Bluple Nitrileexamination Gloves, Non Absorbent Cotton Wool, Absorbent Cotton Wool, Parafilm M125, Sterile Disposablepetri Plates, Disposable Face Masks, Spatula 200, Washbottle Capacity 500ml, Metaloop Ch3, Thump Pressdispensing Dropper, Straight Wire Nichrome  /bid Number: Gem/2025/b/6780307* /dated: 11-10-2025  & & / Bid Document1 / 32

Ref. Document
View Tender
#TBR: 35025393 Closed

Education And Research Institutes

  • Bihar
  • Due On: 23 Aug, 2025 (0 Days Left)

Gem Bids For Physical, Fume Hood Complete Setup Rotavapor Setup Ionexchange Setup Double Stage Laboratory Vacuum Pump Glass Receiver Flask 1000 Ml Silicone Stopper Pack Of 10 Buchner Funnel With Sintered Disc Buchner Funnel Digital Ultrasonic Sonicator Bath Digital Ph Meterbenchtop Water Distillation Unit Silicon Rubber Tubing10m Hotplate And Stirrer With Digital Display Precisionbalances Uv Lamp Chamber Melting Point Apparatus Universal Lab Centrifuge Centrifuge Tubes 15 Ml Digitalpotentiometer Complete Setup Electric Circulating Waterbath 20l Vaccum Desiccator All Clear Pc-pc 250 Mm Vacuum Desiccator All Clear Pc-pc 150 Mm Vacuumdesiccator All Clear Pc-pc 300 Mm Perforatedpolypropylene Disc For Desiccator 150 Mm Perforatedpolypropylene Disc For Desiccator 250 Mm Perforatedpolypropylene Disc For Desiccator 300 Mm Laboratoryoven With Digital Display Ethanol Distillation Glassassembly 1000 Ml Separating Funnel Pear Shaped 500ml Straight Joint Retort Ring For Separating Funnel Rotaryevaporator Flask With I-c Joint 1000 Ml 29-32 Rotaryevaporator Flask With I-c Joint 500 Ml 29-32 Rotaryevaporator Flask With I-c Joint 500 Ml 24-29 Rotaryevaporator Flask With I-c Joint 250 Ml 24-29 Adaptorbent Cone With Stopcock 24-29 Enlarging Connectingadaptors 29-32 24-29 Glass Splash Head Rotavaporadaptor 29-32 24-29 Round Bottom Flask Short Neck 24-29 100 Ml Round Bottom Flask Short Neck 24-29 250ml Round Bottom Flask Short Neck 24-29 500 Ml Round Bottom Flask 2-necked 250 Ml Flask Flat Bottom24-29 250 Ml Flask Flat Bottom 24-29 500 Ml Flaskstand For Round Bottom Flask Liebig Reflux Condenser300 Mm 24-29 Stalganometer Straight Graduated Ostwald Viscometer Screw Pinch Cock For Stalganometer Bid Number Gem2025b6497130 Dated 02-08-2025 Bid Document1 111 0 0 Stand Base And Rod, Retort Stand, , Burette, 50 Ml, , Pippete, 10 Ml, , Capillary, 0.30 Mm Od, , Melting Pointtube, 0.5 Mm, , Measuring Flask With Glass Stopper, 100 Ml,, Erlenmeyer Flask, 250 Ml, With Socket B-24, Glassstopper B-24, Hollow, Hexagonal, , Chromatography Column, Test-tubes, 15 Ml, Pack Of 100, Test-tube Stand, Plastic,, Test-tube Holder, Wash Bottle, 500 Ml, Ldpe, Funnel, 100 Mm, , Funnel, 50 Mm, , Plastic Beakers, 500 Ml, , Plastic Beakers, 1000 Ml, , Beakers, 100 Ml, , Beakers, 1000 Ml, , Conical Flask, 100 Ml, , Spatula Big, 12 Inches, , Spatula, 6 Inches, , Forceps, Steel, 6 Inches, , Filter Papercircle Packet, Rough Filter Paper, 500 Sheets, , Magneticbid, Thermometer, Aspiratory Bottle With Stop Cock, 5000ml, Aspiratory Bottle With Stop Cock, 10000 Ml, Dropper, Glass, 15 Cm With Rubber Teat, Dropping Bottles Withglass Dropper And Silicone Teat, 60 Ml, Droppingbottles With Glass Dropper And Silicone Teat, 125 Ml, Dropping Bottles With Glass Dropper And Silicone Teat, Amber, 60 Ml, Reagent Bottles Narrow Mouth Withscrew Cap, 100 Ml, Reagent Bottles Narrow Mouth Withscrew Cap, 250 Ml, Reagent Bottles Narrow Mouth Withscrew Cap, 500 Ml, Drying Tube 24-29, Nitrile Gloves, Test Tube Brush, Nylon, , Burette Brush, Nylon, , Bottlebrush, Nylon, , Tong For Holding Beaker, 12 Inches, , Tlcplates Silica Gel 60 Matrix, Aluminium Sheet, , Pk Of 25sheets, , Rubber Pipe, 50 Meter, , Surgical Mask Packet, Laboratory Tissue Paper Roll, 190 Pulls 10 Roll, , Ethyleneglycol, Lr, 2.5l, Iso-propyl Alcohol, Lr, 2.5 L, Ethyleneglycol, Ar, 2.5 L, N-hexane, 2.5 L, Chloroform, 2.5 L, Ethylacetate, 2.5 L, Methanol, 2.5 L, Acetone, 2.5 L, Hydrochloric Acid, Conc.,, 2.5 L, Sulphuric Acid, Conc.,, 2.5 L, Nitric Acid, Conc.,, 2.5 L, Glacial Acetic Acid, 2.5 L, Acetylchloride, 500 Ml, Aniline, 500 Ml, Ammonia Water, 2.5 L, Phenolphthalein, 100 G, Eriochrome-black T Powder, 25 G, Methyl Orange, 25 G, Oxalic Acid, 500 G, 1- Naphthol, 100 G, 2-naphthol, 500 G, P-nitrophenol, 250 G, P-nitroaniline, 100 G, Naphthalene, 500 G, Picric Acid, 100 G, Resorcinol, 250 G, Catechol, 250 G, Succinic Acid, 500 G, Cinnamicacid, 250 G, Phthalic Acid, 500 G, Salicylic Acid, 500 G, Pyrogallol, 100 G, D-glucose, 500 G, Sucrose, 500 G, Acetophenone, 500 Ml, Sodium Nitroprusside, 100 G, Methyl Salicylate, 500 Ml, Ammonium Cerric Nitrate, 100 G, Toluene, 500 Ml, Copper Sulphate, 500 G, Diphenylamine, 100 G, Phenol, 500 G, Nitrobenzene, 500ml, Ferric Chloride Anhydrous, 500 G, Zinc Chloride, 500 G, Sodium Metal, 250 G, Potassium Sodium Tartarate, 500 G, 2, 4-dinitrophenyl Hydrazine, 25 G, Pure Bromine, 100 Ml, Benzaldehyde, 500 Ml, Formaldehyde, 500 Ml, Disodiumedta Salt, 500 G, Calcium Carbonate Anhydrous, 500 G, Sodium Bicarbonate, 500 G, Sodium Hydroxide Pellets, 500g, Ammonium Chloride, 500 G, Phthalic Anhydride, 500 G, Sodium Nitrite, 500 G, Silica Gel 60-120 Mesh, 500 G, Charcoal, 500 G, Potassium Permanganate, 500 G, Potassium Dichromate, 500 G, Ammonium Ferrous Sulphatear, 500 G, Silver Nitrate Ar, 25 G, Silver Chloride Ar, 25 G, Calcium Chloride Fused, 500 G, Diethyl Ether, 500 Ml, Paraffin Liquid Heavy, 2.5 L, Neutral Cleaning Solution, 5 L, Silicone Vacuum Grease, 50 G, Iodine, 100 G, Litmus Blueindicator Paper Strips Pkt, 10 Bks, Litmus Red Indicatorpaper Strips Pkt, 10 Bks, Galvanometer, Oscilloscope100mhz, Dc Power Supply, Magnet, Franck-hertzexperiment Apparatus, Four Probe Method Apparatus, Ammeter, Voltmeter, Resistance Box, 1-500 Ohm, , Resistance Box, 1-5000 Ohm, , Dielectric Constant Meter,     //bid Details2 / 111 Newton-s Ring Apparatus, Travelling Microscope, Spectrometer, Plano-convex Lens, Lens Holder, Deflectionmagnetometer, Vibration Magnetometer, Stop Watch, Spirit Level, Digital Vernier Callipers, Physical Balance, He-ne Laser Source, Setup, , Meter Scale

Ref. Document
View Tender
#TBR: 34394119 Closed

Security Services

  • Madhya Pradesh
  • Due On: 01 May, 2025 (0 Days Left)

Gem Bids For 406 Pyrogallol-

Ref. Document
View Tender
#TBR: 34396771 Closed

Power

  • Rajasthan
  • Due On: 10 May, 2025 (0 Days Left)

Gem Bids For Dimethyl glyoxime Grade AR GR Purity minimum 99 PERCENT Packing Size 0.5L Packing Type Glass Bottle Dimethyl Sulphate Grade AR GR Purity minimum 99PERCENT Packing Size 0.5L Packing Type Glass Bottle Mono Ethanol amine Grade Extra pure HPLC Packing Size 0.5L Packing Type Glass Bottle Lithium chloride Grade AR GR Packing Size 500 gm Packing Type plastic Bottle Glycerol Grade AR GR Purity 86-88 PERCENT Packing Size 500ml Packing Type Glass Bottle D-Sorbitol Grade AR GR Purity minimum 99PERCENT Packing Size 500g Packing Type plastic Bottle Potassium Per Sulphate Grade AR GR Purity minimum 99PERCENT Packing Size 500g Packing Type plastic Bottle Pyrogallol Grade AR GR Purity minimum 98PERCENT Packing Size 100g Packing Type Glass Bottle 1,2-Naphthaquinone-4-Sulphonic acid Grade AR GR Purity minimum 97PERCENT Packing Size 10g Packing Type plastic Bottle

Ref. Document
View Tender
#TBR: 34278450 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 16 Apr, 2025 (0 Days Left)

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

Ref. Document
View Tender
#TBR: 34134594 Closed

Education And Research Institutes

  • Uttar Pradesh
  • Due On: 21 Mar, 2025 (0 Days Left)

Supply of Sodium sulphate AR , Potato dextrose broth AR , Tween 80 AR , EtBr MB , Polyethylene glycol 6000 AR , Peptone AR , Sodium Chloride AR , EDTA AR , NitroblueTetrazolum Chloride NBT AR , Ninhydrin AR , Di aminobenzidine AR , Schiff fusion Sulphite reagent AR , HPLC Grade water , Methanol HPLC grade , 1 napthyl ethylenediamine dihydro chloride NEDD , Potassium Chloride AR , Evans blue AR , Chloroform MB , Folin reagent , DEPC , Barium Sulphate AR , Manganese Sulphate AR , Zinc Metal Powder AR , Citric acid powder AR , Sulphanilic acid AR , 1 napthylamine AR , Magnesium Oxide AR , Potassium Nitrate AR , Xylose AR , Sodium dodocyl sulphate MB , Pyrogallol AR , Veratry alcohol AR , Guaiacol AR , Azure B AR , Calcium Chloride AR , Chelex 100 sodium form , 3 point 5 dintroslicylic acid AR , Sodium metasulphite AR , Sodium acetate AR , Dithiothreiol DTT AR , Sodium potassium tartarate AR , Malic acid AR , Phenopthelin AR , Sodium azide AR , Glycerol AR , Sodium hydrogen carbonate AR , L serine AR , Isopropanol AR , Malachite green AR , Remzol brilliant blue AR , Aluminium Chloride AR , Beef extract AR , Tri calcium phosphate , Vanadium chloride AR , Potassium sulphite AR , Ethanol AR , DAPI stain , bisBenzimide , SYBR Green Quantitative RT qPCR Kit QR0100 , Conical flask 50ml , Conical flask 100ml , Conical flask 150ml , Conical flask 250ml , Conical flask 500ml , Petri plates 100 x 17mm , Microscope cover glass , Quartz boiler 5 lit , Plastic pots 30cm dia x 30 cm height , Plastic pots 15cm dia x 15cm height , Dessicator Vacuum pump

Ref. Document
View Tender
#TBR: 34105669 Closed

Chemicals

  • Kerala
  • Due On: 07 Mar, 2025 (0 Days Left)

Supply of AMMONIUM CHLORIDE , ACETONITRILE , BARIUM CHLORIDE , CALCIUM CHLORIDE , CHLOROFORM , DISODIUM HYDROGEN PHOSPHATE , POTASSIUM DIHYDROGEN PHOSPHATE , KARL FISCHER REAGENT , METHANOL , BUFFER TABLET , POTASSIUM BROMIDE , POTASSIUM HYDROGEN PHTHALATE , PYROGALLOL , PETROLEUM ETHER , POTASSIUM THIOCYANATE , POTASSIUM DICHROMATE , SODIUM AZIDE , SODIUM SILICATE , STARCH , SODIUM HYDROXIDE PELLETS , SODIUM CHLORIDE , ACETIC ACID GLACIAL , HYDROCHLORIC ACID , NITRIC ACID , FERRIC CHLORIDE HEXA HYDRATE , SODIUM META BISULPHITE , STANNOUS CHLORIDE , THIO GLYCOLLIC ACID , ORTHO PHOSPHORIC ACID , PHENYL HYDRAZINE , n BUTYL ALCOHOL , ZINC SULPHATE , ALIZARIN RED S , UNIVERSAL INDICATOR SOLUTION

Ref. Document
View Tender
Download Document