"नये भारत का नया Tender Portal"
Request a call back

Latest Tenders for sodium iodide

Total 212 tenders found
#TBR: 34640215 Closed

Railway Transport

  • Jharkhand
  • Due On: 16 Jun, 2025 (0 Days Left)

Supply Of Potassium Iodide + Sodium Chloride + Calcium Chloride Eye Drops.

Ref. Document
View Tender
#TBR: 34402771 Closed

Agricultural And Floriculture And Silviculture Products

  • Maharashtra
  • Due On: 07 May, 2025 (0 Days Left)

Gem Bids For Acetic Acid- Glacial-aldehyde Free , Acetone , Alkali Blue 6b , Ammonium Hydroxide , Ammonium Molybdate , Ammonium Oxalate , Ammonium Thiocynate , Aniline , Bromine Ampule , Calcium Chloride Fused , Carbon Disulphide , Carbon Tetra Chloride , Chloroform , Copper Sulphate , Dextrose Anhydrose , Diethyl Ether , Diphenylcarbazide , Ferric Ammonium Sulphate , Ferric Chloride , Furfural , Glycerol , Hydrochloric Acid , Hydrogen Peroxide , Iodine Monochloride Ampule , Iodine Resublimed , Iso Propanol Hplc , Mercuric Oxide , Methanol Hplc , Methyl Orange , Methylene Blue , Ninhydrine , Nitric Acid , Ptoludine Ar , Barbituric Acid Ar , Oxalic Acid , Petrolium Ether 60 -80c , Phenophthalein , Phenol , Picric Acid , Potassium Chloride , Potassium Chromate , Potassium Dichromate , Potassium Hydroxide , Potassium Iodide , Potassium Sodium Tartarate , Potassium Thyocyanate , Pyridine , Resorcinol , Silver Nitrate , Sodium Acetate , Sodium Carbonate , Sodium Chloride , Sodium Hydroxide , Sodium Thiosulphate , Starch-aracs , Sulphuric Acid , Toluene-rectified , Toluene-hplc Grade , Basic Fuschin , Hexane Hplc Grade , Amyl Alcohol , Rectified Spirit , Boron Trifluoride , Sodium Sulphite Heptahydrate For Jaggery , Rosaniline Hydrochloride For Jaggery , Formaldehyde For Jaggery , Sucrose For Jaggery

Ref. Document
View Tender
#TBR: 34401590 Closed

Education And Research Institutes

  • Orissa
  • Due On: 07 May, 2025 (0 Days Left)

Gem Bids For Charts , Models , Slide Permanent , Specimens , Pictures Posters Charts , Beaker , Dropping Bottle , Forceps , Funnel , Micro Viewers , Microscope , Petri Dish , Pipette , Skeleton , Test Tube Holders , Test Tube Stand , Watch Glass , Water Bath , Wash Bottle , Burette , Capillary Tube , Thermometer , Ammonium Solution , Chromatography Paper , Formaldehyde , Glycerine , Robert Solution , Micro Cover Slip , Micro Glass Slides , Millions Reagent , Needle , Nitric Acid , Sucrose , Test Tube Ordinary , Ph Paper , Blade For Section Cutting , Acetic Acid , Brushes , Blow Pipe , Burette Stand , Test Tube Brush , Cork Borer , Cork Presser , Crucible Tongs , Charcoal Slab Borer , Crucible , Deflagrating Spoon , Distilation Apparatus , Drying Cones , Funnel Stand Or Filter Stand , Pestle And Mortar , Pinch Cock , Retort Stand , Round File , Sand Bath , Spirit Lamp , Test Tube Stand , Test Tube Holder , Triangular Stand , Tripod Stand , Trough , Wire Gauze , Triangular Clay Pipes , Beehie Sheft , Burettle , China Dish , Conical Flasks , Dessicator , Gas Jar Dises , Flasks , Gas Jar Or Cylinder , Glazed Tile , Measuring Flasks , Retort , Thistle Funnel , Woulfes Apparatus , Watch Glass , Ammonium Carbonate , Ammonium Chloride , Ammonium Sulfate , Ammonium Bromide , Aluminum Sulfate , Iron Sticks , Potassium Nitrite , Ammonium Oxalate , Sodium Thiosulphate , Zinc Sulfate , Cobalt Nitrate , Sodium Hydroxide , Copper Sulfate , Potassium Nitrate , Oxalic Acid , Magnesium Sulfate , Magnesium Chloride , Ammonium Phosphate , Sodium Chloride , Potassium Ferrocyanide K4fe Cn 6 , Ferrous Sulfate , Sodium Bromide , Ammonium Ferrous Sulfate , Potassium Dichromate , Barium Chloride , Strontium Nitrate , Sodium Sulphide , Potassium Chromate , Lead Acetate , Sodium Sulfate , Potassium Iodide , Lead Nitrate , Cedric Ammonium Nitrate , 2,4 Dnp , Universal Indicator , Ammonia Solution Nh4oh , Phenol , Aniline , Bromine Water , Acetaldehyde , Fehling Solution A B , Acetone , Carbon Disulfide , Phenolphthalein , Nesslers Reagent , Ammoniumm Olybdate , Nickel Carbonate , Nickel Sulfate , Manganese Chloride , Calcium Chloride , Sodium Bisulphate. , Cobalt Acetate , Chloroform , Magnesium Ribbon , Zinc Granual , Lead Nitrate Pb No3 2 , Potassium Iodide Ki , Lead Metal Pb , Ethyl Acetate , Sodium Metal , Pottasium Permanganet Kmno4 , Pottasium Dichromate K2cr2o7 , Hydro Chloric Acid Hcl , Sulphuric Acid H2so4 , Nitric Acid Hno3 , Ethanol , Test Tube , Test Tube Holder , Dropper Glass , Filter Paper , Glass Rod , Sodium Sulfite , Picric Acid , Borax , Cobalt Glass , Aluminum Metal , Spatula , Laboratory Thermometer , Drawing Board , Friction Apparatus Complete Set With Weight Box , Parallelogram Apparatus , Helical Spring Apparatus With Weights , Resonance Apparatus , Spherometer , Screw Gauge , Wooden Scale , Stopwatch , Sonometer Set , Sprit Level , Vernier Calliper , Beakers , Connecting Wires , Concave Mirror , Convex Mirror , Convex Lens , Concave Lens , Glass Slab , Pendulum Bob , Cork Rubber , Hanger Weights , Metalic Bob , Slinky Spring , Spring Balance , Copper Calorimeter , Wave Pendulum , Barometer Tube , Lactometer , Proof Plane , Boyles Law Apparatus , Fortnis Barometer , Metallic Cylinders Brass , Metal Sphere , Youngs Modulus Apparatus , Hydrometer , Tunning Fork , Rubber Pad , Copper Sulphate

Ref. Document
View Tender
#TBR: 34402035 Closed

Drugs And Pharmaceuticals

  • Jammu And Kashmir
  • Due On: 01 May, 2025 (0 Days Left)

Gem Bids For Bromocresol Purple 25 Gm , 2 Butanol 1 Litre , Benzoic Acid 100 Gm , Crystal Voilet 100 Ml , Ethyl Acetate Hplc Grade 2.5 Litre , 1 Hexane Sulphonic Acid 25 Gm , Isopropyl Alcohol Ipa Hplc Grade 2.5 Litre , Methanol Hplc Grade 2.5 Litre , Methanol Ar Grade 2.5 Litre , Potassium Dichromate 500 Gm , Sodium Acetate 500 Gm , Tetra Butyl Ammonium Hydroxide 100 Ml , Orthophosphoric Acid Hplc Grade 2.5 Litre , Triethylamine Ar Grade 500 Ml , Trypsin 25 Gm , 1 Naphthol 100 Gm , Potassium Chromate 500 Gm , Di Sodium Tartrate Dihydrate 500 Gm , Tetra Hydrofuran Hplc Grade 1 Litre , Dimethylsulphoxide Hplc Grade 1 Litre , Acetonitrile Hplc Grade 2.5 Litre , Acetonitrile Ar Grade 2.5 Litre , Acetone Hplc Grade 2.5 Litre , Acetone Ar Grade 2.5 Litre , Potassium Chloride 500 Gm , Dichloromethane Hplc Grade 2.5 Litre , Mercury Iodide 100 Gm , Sodium Dihydrogen Phosphate 500 Gm , Sodium 1 Decanesulfonate 200 Gm , Fluid Thioglycollate Medium Ftgm 500 Gm , Soyabean Casein Digest Medium Scdm 500 Gm , 1 Chlorobutane 500 Ml , Sterile Cotton Roll 500 Gm , Conical Flask 250 Ml , Clear Reagent Bottle 250 Ml

Ref. Document
View Tender
#TBR: 34278450 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 16 Apr, 2025 (0 Days Left)

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

Ref. Document
View Tender
#TBR: 34280369 Closed

Security Services

  • Punjab
  • Due On: 18 Apr, 2025 (0 Days Left)

Gem Bids For Levodopa 200 Mg Plus Carbidopa 50 Mg Cr Tab , Ranolazine Sr 500 Mg Tab , Pancreatin 10000 Iu Tab , Colchicine 0.5 Mg Tab , Clindamycin 1 Perc Gel 10 Gm , Propranolol Tr 40 Mg Tab , Sulphasalazine 500 Mg Tab , Brimonidine 0.2 Perc Plus Timolol 0.5 Perc Eye Drops , Cap Vitamin Ginsing Mineral Antioxidant , Tab Aceclofenac Paracetamol Serratiopeptidase , Tab L Glutamine 500 Mg , Glutathione 50 Mg Cap , Povidone Plus Iodine Mouth Gargle , Tab Trigabantin 300 Mg Gabapentin Methylcobalamine Alpha Lipoic Acid , Tab Cabergolin 0.5 Mg , Cap Natural Vitamin E Plus Vitamin C Softgel , Tab Spironolactone 25 Mg , Tab Teneligliptin 20 Mg , Tab Gimepiride 2 Mg Plus Voglibose 0.2 Mg Plus Metformin 500 Mg , Glusine Apidra Inj , Desensivity Tooth Paste , E D Olopetadine , E D Ketorolac , Lotion Calamine 100 Ml , Protien Powder Bott Of 200 Gm , Erba Wash 4 Multi 50ml , Albumin Kit 5 Multi 50ml , Cleanac 3 Pack Of 2 Ltr , Total Protien Kit 5 Multi 50ml , Ra Factor 1 Multi 1ml , Pm Kit , Hemolynac 3n Bott Of 500 Ml , L Ornithine L Aspartame Sachet , Cleanac Can Of 5ltr , Clove Oil , Sodium Citrate Esr Tube , Tab Thiocolchicoside Plus Aceclofenac , Tab Telmisartan 80 Mg , Oral Rehydration Salt Ors , Syp Piracetam 500 Mg 5ml , Benzoly Peroxide 2.5 Tube Of 20 Gm , Salicylic Acid 3-5 Perc And Coal Tar 1-3 Perc Soln Bott Of 60 Ml , Gel Kojic Acid Dipalmitate 2.5 Perc, Arbutin1.5 Perc Octinoxate 7.5 Perc And Mulberry Extract1 Perc Tube Of 15 Gm , Lotion Minoxidil 5 Perc Aminexil 1.5 Perc Topical Solution Bott Of 60 Ml , Flucinolone Acetonide Shampoo 0.01 Perc Bott Of 100 Ml , White Soft Paraffin 13.2 Ang Light Liquid Paraffin 10.2 Perc Glycerine 1 Containing Cream Base Jar Of 300 Gm , Lotion Halobetasol 0.05 Bottle Of 30 Ml , Lotion Glycerin Bott Of 400 Ml , Tab Zinc 50 Mg , Acebrophyllin 100mg Acetycstine 600mg Pulmoclear Tab , Acetaminophen 325 Mg Plus Tramadol 37.5 Mg Ultracet Tab , Alovera And Vitamin E Lotion , Alprazolam 0.5 Mg Tab , Amitriptyline 10 Mg Tab , Aripiprazole 5 Mg Tab , Aspirin 75 Mg Plus Atorvastatin 10 Mg Plus Clopidogril 75 Mg Tab , Aspirin 75 Mg Plus Atorvastatin 20 Mg Plus Clopidogril 75 Mg Tab , Asthalin Respules Levolin Resp , Azelasartan 40 Mg Tab , Baclofen 20 Mg Tab , Betahistine 24 Mg Tab , Brivaracetam 100mg Tab , Calcium Vit D3 Syp 200ml Bott , Calcium Carbonate Plus Calcitirol Plus Methulcobalamin Plus Vitamin K2 And Zinc Tab , Capesitabine 400mg Plus Cyclophosphamide 20mg Tab , Carbamazepine 200 Mg Cr Tab , Cefuroxime 500mg Plus Clavuclonic Acid 125 Mg Tab , Chlordiazepoxide 5 Mg Plus Clidinium Bromide 2.5 Mg , Chlorhexidine Mouthwash 2 Perc Bottle Of 150 Ml , Cilinidium Plus Chlordiazepoxide Plus Dicyclomine Tab , Cinitapride 3mg Plus Pantoprazole 40mg Tab , Clarithromycin 250mg Tab , Clobetasol Plus Gentamicin Oint , Clonazepam 2 Mg Tab , Clopidogrel 75 Mg Plus Aspirin 75 Mg Tab , Clozapine 100 Mg Tab , Coenzyme Q10 100 Mg Tab , Coenzyme Q300 Mg Tab , Collagen Peptide Plus Hyaluronate Tab , Combipack Of Amoxicillin 750mg Plus Tinidazole 500 Mg Plus Omeprazole 20 Mg Hp Kit , Daflon 500mg Diosmin 450mg Plus Hesperidin 50mg Tab , Dapagliflozin 10 Mg Plus Metformin 500 Mg Tab , Dienogest 2mg Tab , Disodium Hydrogen Citrate Syrup , Donepezil 5mg Plus Memantine 10mg Tab , Drotaverine Hcl 40 Mg Tab , Ed Bimatoprost 0.01 Perc , Ed Nepafenac 0.1perc W V , Ed Olopatadine Plus Ketorolac Bott Of 10ml , Ed Potassium Iodide Sodium Chloride And Calcium Chloride Calodin 5 Ml , Ed Travaprost Plus Timolol Bott Of 10ml , Enteral Feed Powder Protein 85 Perc Short Chain Peptides 15perc Free Amino Acids Fat 50 Perc Mct 25 Perc Vet Fat Carbohydrate Malto Destri Sht Of 126gm , Eperisone 50 Mg Tab , Escitalopram 5 Mg Plus Clonazepam 0.5 Mg , Escitalopram 5 Mg Plus Clonazepam 0.5 Mg Tab , Evening Primarose 1000 Cap , Fenofibrate 200mg Plus Atorvastatin 10mg Tab , Flupentixol 0.5 Mg Plus Melitracen 10 Mg Tab , Flurbiprofen 0.03 Perc Eye Drop , Fungal Diastace Plus Papaine Plus Activated Charcol Unienzyme , Ginkgo Biloba Tab , Glimepiride 2mg Metformin 500mg Tab , Glimepiride 2 Mg Plus Metformin 500 Mg Sustained Release Tab , Glucose Powder , Heparin 15g 20g Oint , Human Insulin Analogue Aspart Premix 30 Per Insulin 70 Per Insulin Protamine Aspart Suspension 100 Iu Ml 3 Ml Pfs , Hydrochlorothiazide 12.5 Mg Tab , Indapamide 1.5mg Tab , Inh Beclomethason 200mcg 200 Meter Dose Inh , Inh Salmeterol 25mcg Plus Fluticasone 125mcg 120 Mdi , Inh Triohale Tiotropium Bromide 9 Mcg Plus Formoterol 6 Mg Plus Ciclesonide 200mcg 200 Meter Dose Inh , Inj Degludec Insulin Aspart Ryzodeg , Inj Filgrastim 300 Mcg , Inj Human Mixtard 30-70 , Inj Insulin Liraglutide 6mg Ml 18mg Pen , Insulin Humalog Lispro Inj Recombinan Dna Origin 100iu Mlcartidge , Isosorbid 5 Mg Monontrate 30 Mg Tab , Isosorbid Mononitrate 10 Mg Tab , Isosorbide Dinitrate 5 Mg Tab , Ketoconazole Shampoo , Ketoralac 0.2 Perc E D , L Carnitine 500mg Tab , Levocarnitine 500 Mg Tab , Lignocain Plus Gabapentin Oint , Linagliptin 5 Mg Plus Empagliflozin 10 Mg Tab , Liq Paraffin 100 Ml Bott , Losartan 50mg Plus Hydrochlorthiazide 12.5mg Tab , Memantine 5 Mg Plus Donepezil 5 Mg Tab , Mesalamine 400 Gm Tab , Metolazone 2.5 Mg Tab , Metoprolol Xl 12.5 Mg Tab , Midodrine 10mg Tab , Minoxidil 5 Perc W V Lotion 60 Ml , Mirabegron 25mg Plus Solifenacin 5mg Tab , Mirtazapine 7.5 Mg Tab , Montelukast Plus Levocetrizine Plus Acebrophylline 200mg Tab , Multivitamin Plus Multimineral Tab , Multivitamin Syp , Nandrolone Deconate 50 Mg Inj , Nasal Spray Calcitonin 200iu , Nepafenac 0.3 Perc W V5 Ml Ed , Nifedipine Retard 10 Mg Tab , Nitroglycerin 2.6 Mgtab , Omega 3 Fatty Acid Cap , Omega Fatty Acid Plus Antioxidant Cap , Powder Clotrimazole 75 Gm , Propranol 40 Mg Tab , Rabeprazole 20 Mg Plus Levosulpride 75mg Tab , Rabeprazole 20mg Plus Domeperidon 10mg Tab , Ramipril 5 Mg Plus Hydochlorothiazide 12.5 Mg Tab , Risperidone 1 Mg Tab , Rosuvastin 10 Mg Plus Aspirin 75mg Plus Clopidogrel 75 Mg Tab , S Adenosyl L Methionine 200 Mg Tab , Safinamide 50 Mg Tab , Salicylic Acid Plus Coal Tar Oint 40 Gm , Sod Valproate 200 Mg Cr Tab , Sodium Hyaluronate 0.1 Perc Eye Drops E D , Sodium Hypochlorite 5 Perc Solution , Solifenacin 10 Mg Tab , Spirit Bott Of 100ml , Spironolactone 25 Mg Plus Frusemide 20 Mg Tab , Syp Alpha Amylase Pepsin Digestive Enzyme , Syp Liver Tonic , Tab Sodium Valproate 500 Mg Crsodium Valproate 333 Mg Plus Valproic Acid 145mg , Tacrolimus 2 Mg Tab , Tamoxifen 10 Mg Tab , Taurine 500mg Acetylcystine 150mg , Telmisartan 40 Plus Amlodipine 5 Mg Tab , Telmisartan 80 Mg Plus Hctz 12.5mg Tab , Theophylline 400 Mg Tab , Thyroxin 125 Mcg Tab , Thyroxine 12.5 Mcg Tab , Triamcinolone 0.1 Perc Oral Paste , Trimetazidine 60 Sr Tab , Vericiguat 2.5 Mg Tab , Warfarin 2mg Tab , Xylometaloline Hcl 0.05 Perc W V Nasal Drops , Tab Fexofenadine 120mg Plus Montelukast 10mg , Salbutamol Respiratory Solution Bott Of 15ml , Tab Ebastine Plus Montelukast , Tab Vildagliptine 100mg Plus Dapagliptine 10mg , Eperisone 150mg , Tab Doxophylline 400mg Plus Montelukast 10mg , Tab Liv 52 , Tab Clostrum 500mg , Ecg Recording Bpl 9108-d Mch Packet Of 150 , Tab Abiraterone 1gm , Magestrol 40mg 240ml Oral Suspension , Iridoforce Rosehip Ext Vit C Bosewella , Tab Zinc Plus Mecobalamine Plus Pyridoxine Plus Fa Plus Niacanamide And Chrnium , Sitagliptin 100 Mg Tab Plus Metformin 1000 Mg Tab , Inj Sodium Hyaluronate 60mg , Tab Carica Papaya , Tab Diclofenac 50 Mg Plus Paracetamol 325mg , Ethambutol 400 Mg Tab , Syp Hemosef , Tissue Paper Roll , Hiv I And Ii Rapid Card Test Pack Of 50 Test

Ref. Document
View Tender
#TBR: 34279163 Closed

Scientific Research/instruments

  • Maharashtra
  • Due On: 18 Apr, 2025 (0 Days Left)

Gem Bids For 1075 Sodium Thiocyanate Sodium Perchlorate Sodium Iodide Sodium Tetrafluoroborate Sodium Fluoride Sodium Bromide

Ref. Document
View Tender
#TBR: 34271074 Closed

Banking And Mutual Funds And Leasings

  • Haryana
  • Due On: 16 Apr, 2025 (0 Days Left)

Gem Bids For Phenolphathalein , O Toludine , Malachite Green , Sodium Perborate Tetrahydrate , Glacial Acetic Acid , Distilled Water , Benzidine Hydrochloride Sol , 3 Aminophthal Hydrazide , Sodium Hydroxide Flakes , Pyridine , Dextrose , Sodium Chloride , 12 Panel Drub Abuse Kit , Grams Iodine , Potassium Iodide , Picric Acid , Sodium Alpha Naphthyl Phosphate , Fastblue Salt , Potassium Dichromate , Sulphuric Acid , Dragondorfs Reagent , Nesslers Reagent , Schiffs Reagent , Sodium Nitroprusside , Acetone , Mercurous Nitrate , Vanillin Reagent , Formaldehyde , Furfuraldehyde , Cobalt Thiocyante , 4 Dimethylamino Benzaldehyde , Nitric Acid Fuming , Ferrous Sulphate , Sodium Picrate , 3355 Tetrabromophenolphthalein Ethyl Ester , Ferric Chloride , Folin And Ciocalteus Phenol Reagent , Millons Reagent , P Dimethylaminobenzaldehyde , Portable Breath Alcohol Analyzer

Ref. Document
View Tender
#TBR: 34212523 Closed

Security Services

  • Haryana
  • Due On: 26 Mar, 2025 (0 Days Left)

Supply Of Voltmeter , Ammeter , Galvanometer , Stop Watch Racer , Copper Wire Insulated , Copper Sulphate , Ammonium Chloride , Leclanche Cell Complete , Daneil Cell Complete , Parallelogram App , Prism , Optical Bench 1 Mtr , Jockey , Zener Diode , Spring Constant App , Spherometer , Inclined Plane App , Constantin Wire , Rubber Tube 1mm , Mg Ribbon , Bob For Pendulum , Wooden Scale 100cm , Wooden Scale 50cm , Wire For Meter Bridge , Needles For Optical Bench , Helical Springs , Pulley Set For Parellelogram Law Of Forces , Potentiometer , Meter Bridge , Sonometer , Rehostat Long , Two Way Key , One Way Key , Battery Eliminator , Mirror-concave Silver Polish , Mirror- Convex Silver Polish , Mirror Strips , Lens-convex Thick , Laser Light , Electric Bell Demo , Common Household Circuit , Common Electronic Circuit , Torch Rechargeable , Beakers 100ml , Conical Flask 125ml , Burette 50ml , Pipette 10ml , Filter Paper , Ph Paper , Cobalt Nitrate , Copper Sulphate , Disttilled Water , Lead Nitrate , Pottassium Iodide , Starch Soluble , Cobalt Chloride , Ammonium Bromide , Ammonium Acetate , Sodium Hydroxide , Lead Iodide , Litmus Paper , Iron Sulphide Sticks , Mohrs Salt , Potassium Permgnate , Ferric Chloride , Ferrous Sulphate , Acetic Acid , Oxalic Acid , Ammonia Soluion , Bromine Water , Hcl Acid , H2so4 Acid , Nesselers Reagent , Sodium Sulphate , Baking Soda Nahco3 , Blue Ink , Barium Chloride , Sodium Sulphate , Potash Alum , Potassium Chromate , Potassium Dichromate , Patassium Ferricynide , Potassium Ferrocynide , Wire Gauge , Clamps For Burette Stand , Weighing Machine Digital , Test Tubes , Induction Cooker , China Dish , Chromatography Paper , Coloured Charts , Beakers 250ml , Test Tube Holders , Spatula , Droppers , Brushes , Forceps , Scissors , Eye Piece 10x , Objectives 10x , Floroglucinol , Diphenylamine , Silver Nitrate , Acetocarmine , Ammonia Molybedate , Acetone , Petroleum Ether , Glycerol , Nutrient Solution Pollen G , Ethanol , Chromatography Paper , Blades Surgical , Microscope Research , Calcium Oxide , Phenopthalein , Methle Orange , Reagent Bottles 250ml , Safranine , Funnel Glass , Methylene Blue , Potassium Chloride , Sodium Chloride , Digital Weighing Machine , Prepared Slides , Pedigree Charts Autosomal And Sex Linked , Chart Homologous And Analogous , Enzymes Cellulase And Zipase And Pectinase , Enzymes Protease And Ribonuclease , Ice Box

Ref. Document
View Tender
#TBR: 34113606 Closed

Education And Research Institutes

  • Uttar Pradesh
  • Due On: 14 Mar, 2025 (0 Days Left)

Supply of Ammeters different range, Battery eliminator , Daniell cell, Drawing Board , Fricton apparatus complete set with weight box , Galvanometer , Parallelogram apparatus , Key one way , Jockey pencil type , Two way key , Laclanche cell , Meter Bridge , Multimeter Digital , Magnetic compass , Prism (Indian Glass), Potentionmeter , Plier , Cutter , Screwdriver , Dry Cell 10g (chargeable), Helical spring apparatus with weights, Rheostat, resistance coil different range 1-5 ohms, Resonance appartaus , Spherometer , Screw gauge , wooden scale (1-50 cm, 1-100cm), Stopwatch , Sonometer , Sprit level , Thermometer , Tuning Fork (250Hz, 480Hz and 512Hz) withpad, Vernier caliper , Voltmeter ( Different ranges), Breakers, Connecting wires , Charts for display (bio visuals), Portraits (as per choice), Concave mirror , Convex mirror , Convex lens , Concave lens, Wedge knife edge (for sonometer), Glass slab , Pendulum box , Hanger weights 500Gm , Insulated copper wire , Meter Tape (1-100Meter), Spring Balance (0-250gm), u-shaped magnet , Copper colorimeter , Newton's Disc, Camera , lactometer, Binoculars , Boyle's law apparatus, Metallic Cylinders, SG Bottles, Grave s and apparatus, Spirit Level, Potentiometer, Gold leaf electroscope, Tuning fork, Cork rubber 1.5 inches, Dry cell charger, Soldering iron, Eqidiascope, Telescope, Barometer tube, Stove (oil), Elactric bell, Proof Plane, Soldering rods, P-N junction diode set up, Laptop / desktop set, Balance (Physical), Fortnis Barometers, Metal sphere, Young's Modulus, Spectrometer, Hydrometer, Silk And cat skin pieces, Multimeter manual, Optical banch (1 meter long ), Scissor, Resistance Box 0.1 to 10 ohm, Resistance Box 1 to 10 ohm, Resistance Box 1 to 100 ohms , Resistance Box 1 to 1000 ohms, Resistance Box 1 to 100000 ohms, Ammonium Chloride, All Pins 1.5", Copper Sulphate, Drawing Pins, Ammonium Carbonate, Ammonium Chloride, Ammonium Sulfate, Arnn-lci urn Bromide, Arnmen.urn Sulfate, Iron Sticks, Potassium nitrite, Amrncl urn oxalate, Sodium thiosulphate, Zinc SJ1fate, Cobalt nitrate, Sodium hydroxide, Copper sulfate, Potassium nitrate, Oxalic acid, Magnesium Sulfate, Magnes urn chloride, Ammonium phosphate, Sodium chloride, Potassium ferrocyanide, Ferrous sulfate, Sodium bromide, Ammon um ferrous sulfate, Potassium dichromate, Barium chloride, Strontium nitrate, Sodium Sulfide, Potassium Chromate, Lead acetate, Sodium sulfate, Potassium Iodide, Lead nitrate, Cedric ammonium nitrate, 2,4 DNP, Phenol, Aniline, Bromine water, Acetaldehyde, Acetic acid, Carbon disulfide, Phenolphthalein, Nessler' reagent, Ammoniumm olybdate, Nickel ciirbonate, Nickel sulfate, Maganese chloride, Calcium chloride, Sodium bisulphate, Cobalt acetate, Test tube ( 50/125mm), Test lobe holder( thick brass), Dropper glass ( 150mm), Funnel (2"), Pipette ( 10m1) bulb tube, Conical flask (250ml), Volume tric flask (100m1), Filter pacer (12.5cm), Glass rod ( thick), Sodium sulfite, Picric Acid, Borax, Cobalt Glass, Aluminum metal, Spatula, Bunsen ourner, Droppers, Burettec(50m1), Wire gauge, Watch Glass, Tripod stand, Burette stand, Laboratory thermometer (-10 C to 110 C), BalanceChemical), Blow Pipe(Iron), Test Tube Brush, Cork Borer (Iron), Deflagrating spoon (iron), Pestle and Mortar, Pinch Cock (Iron), Retort Stand with Ring and Clamp, Sand Bath, Spirit Lamp (Barss), Test Tube Stand(Wooden), Test Tube Holder (Iron), Triangular Stand (Iron), Tripod Stand (Iron), Wire Gauze (Iron), Beaker , Burette stand(wooden), Cork Presser (iron), Crucible Tongs (iron), Charcoal Slab Borer (iron), Crucible(Silica), Distilation Apparatus (iron), Drying cones (iron), Funnel Stand or Filter Stand (Wooden), Round File, Stoves, Trough (tin), Weight Boxes (woodes), Triangular Clay Pipes (iron wire covered with clay), Burettle, China Dish, Conical Flasks, Flasks (R.B & F.B), Funnel , Gas jar or cylinder, Glazed tile, Measuring Flasks, Pipette, Retort , Thistle Funnel, Kipp's Apparatus, Watch Glass, Beaker 100ml, Beaker 250ml, Beaker 500ml, Chart stand , Conical Flask , Digital balance , Dropping Bottle , Forceps , Funnel , Hot plates , Human Skeleton (Artyficial), Measuring Cylinder 50ml, Measuring Cylinder 100ml, Measuring Cylinder 250ml, Microscope compond , Microscope dissecting , Morter and pastle, Petri dish , Pipette (graduated 10ml), Reagent bottle Slide box, Test tube Holders , test tube stand , Watch glass , Water bath , Wash bottle , White cavity tiles , Pipette stand , Burette (50ml), Burette 50ml, Capillary tube , Tripod stand , Thermometer , trough , Wire gauge , Burette stand , Enamel tray , laboratory coat , Scissors 4", Scissors 6", Scalpel , Staining rack , Controlled pollination and pedigree charts , Roundworm earthworm, and Tapeworm , Pigeon, rat, Scolioses, Starfish, Frog, and Lizard, camel , Claws and beaks forelimbs modifications, brain, ear and eye , Human torso model, and human skeleton model, Aquatic plants, xerophytic plants, monocot plants, dicot plants, Yeast, liverwort, moss, fern, pine, one monocotyledonous, One dicotyledonous plant and one lichen, ameoba , Rohu, frog, lizard, pigeon and rabbit, Stem root and leaf modifications, Disease-causing agents, bread mould, amoeba, Acetic acid , Acetone , Benedicts solution , Ammonium Solution , Dropper, Formaldehyde , Glycerine , Boric acid , Ethanol , Fehling solution A, Fehling solution B, Glucose, Lense cleaning solution , Megnesium sulphate, Robert Solution , Sodium chloride , Sodium Hypobromide , Hydrochloric acid , Cotton blue , Acetic Acid, Alcohol, Aluminum Sulphate, Muslim Cloth, Brushes, Ammonium solution, Cavity block, Caviy Slide, Cellotape/ papertape, Chromatography paper, Cobalt Culoride, Cork, Dusters, Filter Paper, Formal dehyde, Glycerine, Grease, Boric Acid, Momocot Stem, Etnahol, Fehling Solution A, Fehling Solution B, Glvose, Sodium Chloride, Hydroculoride Acide, Iodine, Million's Reagent, Needle, Nitric Acid, Potassium nitrate, Safranin solution, Bile Salts, Starch, Starch iodline, Surcrose, Test tube boiling, Test tube brding, Test tube Graunated, Tooth piks, Aluminum Foil, Barium culoride, Dicot Stem, Urea, PH paper, Multimeter Monnal, Optical bench ( 1 meter long ), Scissor, Dry cell changer, Electric bell, Soldering rods, P-N junction diode setup, Laptop / desktop Set , Spetrometer, Hydrometer, Balance Physics, Thread ralls, Heater, Skeleton (joints), All Pins, Perforated Beaker (250ml), Blade for Section Cutting, Chart display stand

Ref. Document
View Tender
Download Document