"नये भारत का नया Tender Portal"
Request a call back

Latest Tenders for sodium sulfate

Total 206 sodium sulfate tenders found
#TBR: 34401863 Closed

Education And Research Institutes

  • Delhi
  • Due On: 06 May, 2025 (0 Days Left)

Gem Bids For Co2 Cylinder , Megascrip T7 Transcription Kit By Thermofisher , One-step Capping And 2 Omethylation Reaction Kit , Millipore Ziptips C18 , Lipofectamine Messengermax As The Transfection Reagent , Dithiothreitol , Edta Tubes K2 K3 3ml , Protease Inhibitor Cocktail , Lysing Kit - Tissue Homogenizing Ck28 7ml , Goat Anti-pah Polyclonal Antibody , Donkey Anti-goat Immunoglobulin G H L -horseradish Peroxidaseconjugate , Pvdf Membrane , Ecl Western Blotting Reagents , Hyperfilm Ecl W X L 18 Cm X 24 Cm Pack Of 100 Each , Dnase I 100mg , 96 Well Plate Collagen I Coated Surface Pack Of 5 , L-phenylalanine - 500g , Rpmi 1640 Medium 10x500ml , Gfp Polyclonal Antibody Alexa Fluor 488 , Potassium Test 100 Tests , Assay Kit Colorimetric 100 Tests , Chloride Assay Kit 100 Tests , Alt Activity Assay 100 Tests , Bcp Albumin Assay Kit 250 Tests , Alkaline Phosphatase Assay Kit 250 Test , Ast Activity Assay Kit , Bilirubin Assay Kit Tests , Calcium Colorimetric Assay 250 Tests , Cholesterol Quantitation Kit 100 Tests , Creatine Kinase Activity Assay Kit 100 Tests , Total Protein Kit , Glucose Assay Kit 20 Assays , Phosphate Assay Kit 500 Tests , Urea Assay Kit 100 Tests , Centrifuge Tubes 50ml , Centrifuge Tubes 15 Ml , Microcentrifuge Tubes 1.5 Ml , Microcentrifuge Tubes 2 Ml , Microcentrifuge Tips 1 Ml , Microcentrifuge Tips 10 Microliters , Microcentrifuge Tips 200 Microliters , Dmem Media , Fetal Bovine Serum , Dmso , Western Blot Power Supply , Western Blot Apparatus , Serotonin Assay Kit , Dopamine Assay Kit , Parafilm , Culture Flasks T-25 , Culture Flasks T-175 , 12 Well Culture Plates , 96 Well Culture Plates , 24 Well Plates , 6 Well Plates , Paraformaldeyde , Triton X 100 , Bsa , Trypsin-edta With Phenol Red And Edta , Gapdh Loading Control Rabbit , Anti Gapdh Antibody Rabbit , Hepes Buffer , Dmg Peg 2000 , Electrophoresis Power Supply , Electrophoresis Apparatus , Centrifuge Tips Autoclavable 10 Ul , Centrifuge Tips Autoclavable 200 Ul , Centrifuge Tips Autoclavable 1000 Ul , Storage Glass Bottle Autoclavable 100 Ml , Storage Glass Bottle Autoclavable 500 Ml , Storage Glass Bottle Autoclavable 1000 Ml , Microfuge Stands , Microtube Rack , Conical Tube Racks , Measuring Cylinders 100 Ml , Measuring Cylinders 500 Ml , Measuring Cylinders 1000 Ml , Filtering Membrane 0.22 Micron , Filtering Membrane 0.45 Micron , Spray Bottle , Tissue Rolls , Autocolavable Plastic Bags , Glass Beakers 50 Ml 100 Ml , Glass Conical Flasks 100 Ml 200 Ml 500 Ml , Antibiotic Antimitotic Solution , Gloves , Vacuum Pump And Discard Apparatus , Membrane Filter Holder 47mm , Hemocytometer , Disposable Pipettes 1ml , Disposable Pipettes 2 Ml , Disposable Pipettes 5 Ml , Disposable Pipettes 10 Ml , Polyethersulfone Membrane Pore Size 0.2 Um , Polyethersulfone Membrane Pore Size 0.45 Um , Microcentrifuge Tipbox , Micropipette P10 1-10 Ul , Micropipette P20 2-20 Ul , Micropipette P200 20-200 Ul , Micropipette P1000 100-1000 Ul , Micropipette 0.5-10 Ul , Prestained Protein Ladder , Multicolor Low Range Protein Ladder 250 Ul , 8 Channel Multi Channel Pipette , Glass Pipettes 2 Ml , Glass Pipettes 1 Ml , Glass Pipettes 5ml , Glass Pipettes 10 Ml , Glass Pipettes 0.1 Ml , Glass Pipettes 0.2 Ml , Temed -ar Grade , Ficoll Hypaque Density Gradient Media -ar Grade , Formaldehyde -ar Grade , Cotton Roll , Petroleum Ether -ar Grade , N- Butanol -ar Grade , Isopropanol -ar Grade , Agarose Medium Eeo -ar Grade , Glacial Acetic Acid -ar Grade , Methanol -ar Grade , Acetic Acid Aldehyde Free -ar Grade , Ethanol -ar Grade , Sucrose - Ar Grade , Butter Paper Sheets , Tris-hcl , Ether , Methanol , Acetyl Acetone , Dodecyl , Cryogenic Tube With Screw Cap , Cryo Gloves , Cryogenic Boxes Racks , Cryogenic Mini Cooler , Edta , Acrylamide , Bis Acrylamide , Ammonium Per Sulphate , Lab Spatula , Precision Weighing Balance , Pipet Tips For Gel Loading

Ref. Document
View Tender
#TBR: 34401590 Closed

Education And Research Institutes

  • Orissa
  • Due On: 07 May, 2025 (0 Days Left)

Gem Bids For Charts , Models , Slide Permanent , Specimens , Pictures Posters Charts , Beaker , Dropping Bottle , Forceps , Funnel , Micro Viewers , Microscope , Petri Dish , Pipette , Skeleton , Test Tube Holders , Test Tube Stand , Watch Glass , Water Bath , Wash Bottle , Burette , Capillary Tube , Thermometer , Ammonium Solution , Chromatography Paper , Formaldehyde , Glycerine , Robert Solution , Micro Cover Slip , Micro Glass Slides , Millions Reagent , Needle , Nitric Acid , Sucrose , Test Tube Ordinary , Ph Paper , Blade For Section Cutting , Acetic Acid , Brushes , Blow Pipe , Burette Stand , Test Tube Brush , Cork Borer , Cork Presser , Crucible Tongs , Charcoal Slab Borer , Crucible , Deflagrating Spoon , Distilation Apparatus , Drying Cones , Funnel Stand Or Filter Stand , Pestle And Mortar , Pinch Cock , Retort Stand , Round File , Sand Bath , Spirit Lamp , Test Tube Stand , Test Tube Holder , Triangular Stand , Tripod Stand , Trough , Wire Gauze , Triangular Clay Pipes , Beehie Sheft , Burettle , China Dish , Conical Flasks , Dessicator , Gas Jar Dises , Flasks , Gas Jar Or Cylinder , Glazed Tile , Measuring Flasks , Retort , Thistle Funnel , Woulfes Apparatus , Watch Glass , Ammonium Carbonate , Ammonium Chloride , Ammonium , Ammonium Bromide , Aluminum , Iron Sticks , Potassium Nitrite , Ammonium Oxalate , Thiosulphate , Zinc , Cobalt Nitrate , Hydroxide , Copper , Potassium Nitrate , Oxalic Acid , Magnesium , Magnesium Chloride , Ammonium Phosphate , Chloride , Potassium Ferrocyanide K4fe Cn 6 , Ferrous , Bromide , Ammonium Ferrous , Potassium Dichromate , Barium Chloride , Strontium Nitrate , Sulphide , Potassium Chromate , Lead Acetate , , Potassium Iodide , Lead Nitrate , Cedric Ammonium Nitrate , 2,4 Dnp , Universal Indicator , Ammonia Solution Nh4oh , Phenol , Aniline , Bromine Water , Acetaldehyde , Fehling Solution A B , Acetone , Carbon Disulfide , Phenolphthalein , Nesslers Reagent , Ammoniumm Olybdate , Nickel Carbonate , Nickel , Manganese Chloride , Calcium Chloride , Bisulphate. , Cobalt Acetate , Chloroform , Magnesium Ribbon , Zinc Granual , Lead Nitrate Pb No3 2 , Potassium Iodide Ki , Lead Metal Pb , Ethyl Acetate , Metal , Pottasium Permanganet Kmno4 , Pottasium Dichromate K2cr2o7 , Hydro Chloric Acid Hcl , Sulphuric Acid H2so4 , Nitric Acid Hno3 , Ethanol , Test Tube , Test Tube Holder , Dropper Glass , Filter Paper , Glass Rod , Sulfite , Picric Acid , Borax , Cobalt Glass , Aluminum Metal , Spatula , Laboratory Thermometer , Drawing Board , Friction Apparatus Complete Set With Weight Box , Parallelogram Apparatus , Helical Spring Apparatus With Weights , Resonance Apparatus , Spherometer , Screw Gauge , Wooden Scale , Stopwatch , Sonometer Set , Sprit Level , Vernier Calliper , Beakers , Connecting Wires , Concave Mirror , Convex Mirror , Convex Lens , Concave Lens , Glass Slab , Pendulum Bob , Cork Rubber , Hanger Weights , Metalic Bob , Slinky Spring , Spring Balance , Copper Calorimeter , Wave Pendulum , Barometer Tube , Lactometer , Proof Plane , Boyles Law Apparatus , Fortnis Barometer , Metallic Cylinders Brass , Metal Sphere , Youngs Modulus Apparatus , Hydrometer , Tunning Fork , Rubber Pad , Copper Sulphate

Ref. Document
View Tender
#TBR: 34401936 Closed

Power

  • Rajasthan
  • Due On: 08 May, 2025 (0 Days Left)

Gem Bids For 69 Diphenylcarbazide Q3 Ammonium Acetate Q3 Conductivity Standard Solution Q3 Mercuric Chloride Q3 Potassium Dichromate Q3 Potassium Hydrogen Pthalate Q3 Silver Nitrate As Per Is 2214 Q3 Silver Q3 Acetate Q3 Mercuric Sulphate Q3

Ref. Document
View Tender
#TBR: 34346159 Closed

Health Services/equipments

  • Kerala
  • Due On: 29 Apr, 2025 (0 Days Left)

Gem Bids For Hisep Tm Lsm1077 Tris Base Tris Glycine Sds Buffer Immun Blot Pvdf Membrane Clarity Ecl Substrate Precision Plus Protein Dodecyl

Ref. Document
View Tender
#TBR: 34278450 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 16 Apr, 2025 (0 Days Left)

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Carbonate 500 G , Thiobarbituric Acid 125 G , Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Feso4 500 G , Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

Ref. Document
View Tender
#TBR: 34113606 Closed

Education And Research Institutes

  • Uttar Pradesh
  • Due On: 14 Mar, 2025 (0 Days Left)

Supply of Ammeters different range, Battery eliminator , Daniell cell, Drawing Board , Fricton apparatus complete set with weight box , Galvanometer , Parallelogram apparatus , Key one way , Jockey pencil type , Two way key , Laclanche cell , Meter Bridge , Multimeter Digital , Magnetic compass , Prism (Indian Glass), Potentionmeter , Plier , Cutter , Screwdriver , Dry Cell 10g (chargeable), Helical spring apparatus with weights, Rheostat, resistance coil different range 1-5 ohms, Resonance appartaus , Spherometer , Screw gauge , wooden scale (1-50 cm, 1-100cm), Stopwatch , Sonometer , Sprit level , Thermometer , Tuning Fork (250Hz, 480Hz and 512Hz) withpad, Vernier caliper , Voltmeter ( Different ranges), Breakers, Connecting wires , Charts for display (bio visuals), Portraits (as per choice), Concave mirror , Convex mirror , Convex lens , Concave lens, Wedge knife edge (for sonometer), Glass slab , Pendulum box , Hanger weights 500Gm , Insulated copper wire , Meter Tape (1-100Meter), Spring Balance (0-250gm), u-shaped magnet , Copper colorimeter , Newton's Disc, Camera , lactometer, Binoculars , Boyle's law apparatus, Metallic Cylinders, SG Bottles, Grave s and apparatus, Spirit Level, Potentiometer, Gold leaf electroscope, Tuning fork, Cork rubber 1.5 inches, Dry cell charger, Soldering iron, Eqidiascope, Telescope, Barometer tube, Stove (oil), Elactric bell, Proof Plane, Soldering rods, P-N junction diode set up, Laptop / desktop set, Balance (Physical), Fortnis Barometers, Metal sphere, Young's Modulus, Spectrometer, Hydrometer, Silk And cat skin pieces, Multimeter manual, Optical banch (1 meter long ), Scissor, Resistance Box 0.1 to 10 ohm, Resistance Box 1 to 10 ohm, Resistance Box 1 to 100 ohms , Resistance Box 1 to 1000 ohms, Resistance Box 1 to 100000 ohms, Ammonium Chloride, All Pins 1.5", Copper Sulphate, Drawing Pins, Ammonium Carbonate, Ammonium Chloride, Ammonium , Arnn-lci urn Bromide, Arnmen.urn , Iron Sticks, Potassium nitrite, Amrncl urn oxalate, thiosulphate, Zinc SJ1fate, Cobalt nitrate, hydroxide, Copper , Potassium nitrate, Oxalic acid, Magnesium , Magnes urn chloride, Ammonium phosphate, chloride, Potassium ferrocyanide, Ferrous , bromide, Ammon um ferrous , Potassium dichromate, Barium chloride, Strontium nitrate, Sulfide, Potassium Chromate, Lead acetate, , Potassium Iodide, Lead nitrate, Cedric ammonium nitrate, 2,4 DNP, Phenol, Aniline, Bromine water, Acetaldehyde, Acetic acid, Carbon disulfide, Phenolphthalein, Nessler' reagent, Ammoniumm olybdate, Nickel ciirbonate, Nickel , Maganese chloride, Calcium chloride, bisulphate, Cobalt acetate, Test tube ( 50/125mm), Test lobe holder( thick brass), Dropper glass ( 150mm), Funnel (2"), Pipette ( 10m1) bulb tube, Conical flask (250ml), Volume tric flask (100m1), Filter pacer (12.5cm), Glass rod ( thick), sulfite, Picric Acid, Borax, Cobalt Glass, Aluminum metal, Spatula, Bunsen ourner, Droppers, Burettec(50m1), Wire gauge, Watch Glass, Tripod stand, Burette stand, Laboratory thermometer (-10 C to 110 C), BalanceChemical), Blow Pipe(Iron), Test Tube Brush, Cork Borer (Iron), Deflagrating spoon (iron), Pestle and Mortar, Pinch Cock (Iron), Retort Stand with Ring and Clamp, Sand Bath, Spirit Lamp (Barss), Test Tube Stand(Wooden), Test Tube Holder (Iron), Triangular Stand (Iron), Tripod Stand (Iron), Wire Gauze (Iron), Beaker , Burette stand(wooden), Cork Presser (iron), Crucible Tongs (iron), Charcoal Slab Borer (iron), Crucible(Silica), Distilation Apparatus (iron), Drying cones (iron), Funnel Stand or Filter Stand (Wooden), Round File, Stoves, Trough (tin), Weight Boxes (woodes), Triangular Clay Pipes (iron wire covered with clay), Burettle, China Dish, Conical Flasks, Flasks (R.B & F.B), Funnel , Gas jar or cylinder, Glazed tile, Measuring Flasks, Pipette, Retort , Thistle Funnel, Kipp's Apparatus, Watch Glass, Beaker 100ml, Beaker 250ml, Beaker 500ml, Chart stand , Conical Flask , Digital balance , Dropping Bottle , Forceps , Funnel , Hot plates , Human Skeleton (Artyficial), Measuring Cylinder 50ml, Measuring Cylinder 100ml, Measuring Cylinder 250ml, Microscope compond , Microscope dissecting , Morter and pastle, Petri dish , Pipette (graduated 10ml), Reagent bottle Slide box, Test tube Holders , test tube stand , Watch glass , Water bath , Wash bottle , White cavity tiles , Pipette stand , Burette (50ml), Burette 50ml, Capillary tube , Tripod stand , Thermometer , trough , Wire gauge , Burette stand , Enamel tray , laboratory coat , Scissors 4", Scissors 6", Scalpel , Staining rack , Controlled pollination and pedigree charts , Roundworm earthworm, and Tapeworm , Pigeon, rat, Scolioses, Starfish, Frog, and Lizard, camel , Claws and beaks forelimbs modifications, brain, ear and eye , Human torso model, and human skeleton model, Aquatic plants, xerophytic plants, monocot plants, dicot plants, Yeast, liverwort, moss, fern, pine, one monocotyledonous, One dicotyledonous plant and one lichen, ameoba , Rohu, frog, lizard, pigeon and rabbit, Stem root and leaf modifications, Disease-causing agents, bread mould, amoeba, Acetic acid , Acetone , Benedicts solution , Ammonium Solution , Dropper, Formaldehyde , Glycerine , Boric acid , Ethanol , Fehling solution A, Fehling solution B, Glucose, Lense cleaning solution , Megnesium sulphate, Robert Solution , chloride , Hypobromide , Hydrochloric acid , Cotton blue , Acetic Acid, Alcohol, Aluminum Sulphate, Muslim Cloth, Brushes, Ammonium solution, Cavity block, Caviy Slide, Cellotape/ papertape, Chromatography paper, Cobalt Culoride, Cork, Dusters, Filter Paper, Formal dehyde, Glycerine, Grease, Boric Acid, Momocot Stem, Etnahol, Fehling Solution A, Fehling Solution B, Glvose, Chloride, Hydroculoride Acide, Iodine, Million's Reagent, Needle, Nitric Acid, Potassium nitrate, Safranin solution, Bile Salts, Starch, Starch iodline, Surcrose, Test tube boiling, Test tube brding, Test tube Graunated, Tooth piks, Aluminum Foil, Barium culoride, Dicot Stem, Urea, PH paper, Multimeter Monnal, Optical bench ( 1 meter long ), Scissor, Dry cell changer, Electric bell, Soldering rods, P-N junction diode setup, Laptop / desktop Set , Spetrometer, Hydrometer, Balance Physics, Thread ralls, Heater, Skeleton (joints), All Pins, Perforated Beaker (250ml), Blade for Section Cutting, Chart display stand

Ref. Document
View Tender
#TBR: 34104245 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 14 Mar, 2025 (0 Days Left)

Supply of 4 Aminophenol 250gm , 4 Bromo Aniline 25gm , Acetic acid Glacial 2500 ml , Acetone 2500 ml , Ammonia Solution Extra Pure 500 ml , Amoxicillin 1 gm , Ascorbic acid 25g , Benzaldehyde for Synthesis 500 mL , Cerium Nitrate hexahydrate 100g , Chloroform 2500 ml , Cobalt Chloride Hexahydrate 100gm , Copper Chloride anhydrous 250 gm , Copper Chloride dihydrate 500 gm , Diethyl ether 2500 ml , Dimethyl Sulphoxide 500ml , Ethanol 500ml , Ethyl Acetate 2500 ml , Hexadecyltrimethylammonium bromide 25g , Hexane 2500 ml , Hydrazine Hydrate 500ml , Hydroxy propyl Cellulose 5g , Iron II Sulphate 250g , Iso Propanol 2500 ml , Levofloxacin 1 gm , Lithium Aluminium Hydride for Synthesis 97 Percent 100 gm , L Phenylalanine 25g , Methanol 2500 ml , Methylene Chloride 2500ml , Millons Reagent 125 ml , Morpholine 500ml , N N Dimethyl Formamide 500 ml , N N methylenebisacrylamide 25g , Nitro Benzene 500ml , Para Toluene Sulphonic Acid 100gm , Paraffin Liquid Light 500ml , Polyvinylpyrrolidone 100g , Pyridine 500ml , Pyrrol 2 carboxaldehyde 5g , Rodamine B 25gm , Salicylaldehyde 100g , Schiffs Reagent 500 ml , Selenous acid 50g , Silica Gel G 500gm , Chloride 500gm , Dodecyl 500g , Metal Pieces in Kerosene or Liquid Paraffin 500 gm , selenite 100g , Strontium Nitrate 500 gm , Succinic Acid 100gm , Sulphuric Acid 5000ml , Tempo 25 gm , Tetracycline 5 gm , Thioacetamide 100 gm , Thiophene for Synthesis 100 mL , Tollens Reagent 100 ml , Toulene 2500 ml , Tryptophan 25 gm , Yattrium III nitrate hexahydrate 25 gm , Zinc Chloride 500 gm , Zinc Dust 500 gm , Zirconium Oxychloride 500 gm

5.00 Lacs
View Tender
#TBR: 34106492 Closed

Education And Research Institutes

  • Kerala
  • Due On: 14 Mar, 2025 (0 Days Left)

Supply of PERIODIC ACID, REAGENTPLUS TM , INSULIN SOLUTION, HUMAN RECOMBINANT , Schiff reagent 1090330500 , p Nitrophenyl a D glucopyran 1PC X 1GM , A GLUCOSIDASE TYPE I FROM BAKERS , POTASSIUM DIHYDR. PHOSPH. P.A. EMSURE , CARBONATE ANHYDR. P.A. EMSURE , ACARBOSE , DIPEPTIDYL PEPTIDASE IV INHIBITOR I , Gly-Pro p-nitroanilide hydrochloride , DIPEPTIDYL PEPTIDASE IV, HUMAN , QUERCETIN, 95 HPLC, SOLID , GLYCINE, NONANIMAL SOURCE , POTASSIUM CHLORIDE CELL CULTURE , POTASSIUM PHOSPHATE MONOBASIC , bicarbonate powder, 1Kg , EDTA solution for cell culture , D GLUCOSE, POWDER, BIOREAGENT , DODECYL , TRIS HYDROXYMETHYL AMINOMETHANE GR , MAGNESIUM , TRI REAGENT , GLYCEROL, FOR MOLECULAR BIOLOGY , SUCROSE , SILICA GEL 60-120 MESH FOR C 500 G , SILICA GEL 100-200 MESH FOR 500 G , PANCREATIN FROM PORCINE PANCREAS , BILE SALTS , ALUMINIUM CHLORIDE ANHYDROUS POWDER , ACETATE ANHYDROUS , 2,2-Diphenyl-1-picrylhydrazyl , Nitroprusside, Dihydr 1PC X 100MG , SULFANILIC ACID 99 percent AC S REAGENT , N 1 NAPHTHYL ETHYLENEDIAMINE , NBT, SOLUTION , ALPHA GLUCOSIDASE ASSAY , PHENAZINE METHO , NADH, APPROX. 98 , 1 G , FOLIN CIOCALTEUS PHENOL REAGENT , DINITROSALICYLIC ACID, 98 , A AMYLASE, HEAT STABLE, FOR TOTAL , TLC aluminum sheets, Silica gel 60 F

Ref. Document
View Tender
#TBR: 34089937 Closed

Education And Research Institutes

  • Delhi
  • Due On: 11 Mar, 2025 (0 Days Left)

Supply of CO2 cylinder , MEGAscrip T7 Transcription Kit by Thermofisher , one-step capping and 2 Omethylation reaction kit , Millipore Ziptips C18 , Lipofectamine MessengerMax as the transfection reagent , Dithiothreitol , EDTA tubes K2 K3 3ml , Protease Inhibitor Cocktail , Lysing kit - Tissue homogenizing CK28 7mL , Goat anti-PAH polyclonal antibody , donkey anti-goat immunoglobulin G H L -horseradish peroxidaseConjugate , PVDF Membrane , ECL Western Blotting Reagents , Hyperfilm ECL W x L 18 cm x 24 cm pack of 100 each , DNase I 100MG , 96 Well Plate Collagen I Coated Surface Pack of 5 , L-Phenylalanine - 500G , RPMI 1640 Medium 10x500ml , GFP Polyclonal Antibody Alexa Fluor 488 , Potassium Test 100 tests , Assay Kit Colorimetric 100 tests , Chloride Assay Kit 100 tests , ALT Activity Assay 100 tests , BCP Albumin Assay Kit 250 tests , Alkaline Phosphatase Assay Kit 250 test , AST Activity Assay Kit , Bilirubin Assay Kit tests , Calcium Colorimetric Assay 250 tests , Cholesterol Quantitation Kit 100 tests , Creatine Kinase Activity Assay Kit 100 tests , Total protein kit , Glucose assay kit 20 assays , Phosphate assay kit 500 tests , Urea Assay kit 100 tests , centrifuge tubes 50ml , centrifuge tubes 15 ml , microcentrifuge tubes 1.5 ml , microcentrifuge tubes 2 ml , microcentrifuge tips 1 ml , microcentrifuge tips 10 microliters , microcentrifuge tips 200 microliters , DMEM media , Fetal Bovine Serum , DMSO , Western Blot power supply , Western Blot Apparatus , Serotonin Assay Kit , Dopamine assay Kit , Parafilm , Culture Flasks T-25 , Culture Flasks T-175 , 12 well culture Plates , 96 well culture Plates , 24 well plates , 6 well plates , Paraformaldeyde , Triton X 100 , BSA , Trypsin-EDTA with Phenol Red and EDTA , GAPDH loading control rabbit , anti GAPDH antibody rabbit , HEPES Buffer , DMG PEG 2000 , Electrophoresis power supply , Electrophoresis Apparatus , centrifuge tips autoclavable 10 ul , centrifuge tips autoclavable 200 ul , centrifuge tips autoclavable 1000 ul , Storage glass bottle autoclavable 100 ml , Storage glass bottle autoclavable 500 ml , Storage glass bottle autoclavable 1000 ml , Microfuge stands , Microtube Rack , Conical Tube Racks , Measuring cylinders 100 ml , Measuring cylinders 500 ml , Measuring cylinders 1000 ml , Filtering membrane 0.22 micron , Filtering membrane 0.45 micron , Spray bottle , Tissue rolls , Autocolavable plastic bags , glass beakers 50 ml 100 ml , glass Conical flasks 100 ml 200 ml 500 ml , Antibiotic antimitotic solution , Gloves , Vacuum pump and discard apparatus , Membrane Filter Holder 47mm , hemocytometer , Disposable pipettes 1ml , Disposable pipettes 2 ml , Disposable pipettes 5 ml , Disposable pipettes 10 ml , polyethersulfone membrane pore size 0.2 um , polyethersulfone membrane pore size 0.45 um , Microcentrifuge Tipbox , micropipette P10 1-10 uL , micropipette P20 2-20 uL , micropipette P200 20-200 uL , micropipette P1000 100-1000 uL , micropipette 0.5-10 uL , Prestained Protein Ladder , Multicolor Low Range Protein Ladder 250 uL , 8 channel Multi Channel Pipette , Glass Pipettes 2 ml , Glass Pipettes 1 ml , Glass Pipettes 5ml , Glass Pipettes 10 ml , Glass Pipettes 0.1 ml , Glass Pipettes 0.2 ml , TEMED -AR grade , Ficoll Hypaque density gradient media -AR grade , Formaldehyde -AR grade , Cotton roll , Petroleum Ether -AR grade , n- Butanol -AR grade , Isopropanol -AR grade , Agarose Medium EEO -AR grade , Glacial acetic acid -AR grade , Methanol -AR grade , Acetic acid aldehyde free -AR grade , Ethanol -AR grade , Sucrose - AR grade , Butter paper sheets , Tris-HCl , Ether , Methanol , Acetyl Acetone , dodecyl , cryogenic tube with screw cap , Cryo Gloves , cryogenic boxes racks , cryogenic mini cooler , EDTA , acrylamide , bis acrylamide , ammonium per sulphate , Lab Spatula , Precision weighing Balance , Pipet Tips for Gel Loading

18.00 Lacs
View Tender
#TBR: 34014799 Closed

Railway Transport

  • Chhattisgarh
  • Due On: 25 Feb, 2025 (0 Days Left)

Supply of Tab. L-Arginine, Collagen Peptides Type-I, Hyaluronate, Chondroitin And Vitamin C Tab. L-Arginine, Collagen Peptides Type-I, Hyaluronate, Chondroitin And Vitamin C Tab. L-Arginine, Collagen Peptides Type-I, Hyaluronate, Chondroitin And Vitamin C

Ref. Document
View Tender
Download Document