"नये भारत का नया Tender Portal"
Tender Bharat Website covers all Tenders for bile broth – Including bile broth Government Tenders, e Tender bile broth, bile broth Tenders and Private Tenders. There is no shortage of business opportunities from the largest bile broth Tender Database.
Our website allows you to find bile broth tenders online quickly and easily. Subscribers can also opt to receive daily tender alerts through email from TenderBharat.com to guarantee they don't miss out on any opportunities.
Gem Bids For Culture Media, 14541 Palcam Aloa Agar Tsc Agar Sb Medium Mineral Modified Glutamate Medium Bismuth Sulphite Agar Onpg Kings Medium B Base Shigella Base Sulfite Indole Motility Agar Differential Reinforced Clostridial Base Chromogenic Coliform Agar Soyabean Casein Digest Medium Buffered Peptone Water Potato Dextrose Agar Alkaline Peptone Water Brilliant Green Myp Agar Base Chrom Agar Vibrio Bromcresol Purple Bcp Dextrose
Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey 500 G , Mha Muller Hinton 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 500 G , Ox Ox Gall 500 G , Mha Agar 500 G , Mrs 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient 500 G
Supply of Hydrochloric Acid , Conc. Sulphuric acid , Nitric Acid , Perchloric Acid , Potassium dihydrogen phosphate , Magnesium sulphate heptahydrate , Gluconic acid , Boric acid , Copper sulphate pentahydrate , Molybdenum trioxide , Ferric chloride , HDTMA , Glycerol , Sucrose , Di potassium hydrogen phosphate , Sodium molybdate , Calcium carbonate , two four dinitrophenyl hydragine , Tris HCL buffer , Lead nitrate , Nutrient agar , Gram stain kit , Hi assorted biochemical test kit , Sodium bicarbonate , Picric acid liquid , Glycine , ACC , Slide , Normal glass spreader , Test tube , Ethanol , Test tube rack , PTFE Syringe Filter , Cover Slip , Purple nitrile gloves , Lauryl Tryptose , Brilliant green lactose , Eosine Methylene blue , Starch Powder , Ethylene diamine tetra acetic acid , Ammonium Solution , Ammonium Hydroxide , Eriochrome Black T , Silver Sulfate , Sulphamic Acid , Mercuric Sulfate , Ferroin Indicator , Calcium Chloride , Magnesium Sulfate , Sodium Azide , Volumetric Flask I , Volumetric Flask II , Volumetric Flask III , Conical Flask I , Conical Flask II , Reagent Bottle , Pipette I , Pipette II , Pipette III , Wash Bottle , Dropper , Pipette sucker , Gloves , Potassium Dichromate , Ferrous Ammonium Sulfate , Diphenylamine , Orthophosphoric acid , Sodium Fluoride , Potassium permanganate , Sodium Hydroxide , Sodium Carbonate , Bromocresol green , Methyl red , Potassium Dihydrogen Phosphate , two four Dinitrophenol , Sodium Bicarbonate , Ammonium molybdate , Ascorbic acid , Antimony Potassium tartrate , Activated charcoal , Calcium chloride , Sulphamic acid , Silver sulphate , Mercuric sulphate , Ammonium chloride , Eriochrome black T , Ethyl alcohol , Phenolphthalein indicator , Potassium phthalate , Methyl alcohol , Tissue Roll , Ammonium hydroxide
Supply of Buffer solution. pH-4.0, CRM, As per ISO 17034 , Buffer solution. pH-7.0, CRM, As per ISO 17034 , Buffer solution. pH-9.0, CRM as per ISO 17034 , Potassium chloride solution CRM, As per ISO 17034 , Ammonia CRM, As per ISO 17034 , BOD Standard CRM, As per ISO 17034 , Potassium hydrogen di-iodate CRM Solution, As per ISO 17034 , Glacial Acetic Acid 99 percent , Nitric Acid 69 percent suprapur , Magnesium Chloride , Manganese II, Sulphate monohydrate , Silver Nitrate , Sodium Iodide , Sodium Hydroxide , Calcium Chloride Fused , Barium Chloride Dihydrate , Sulphuric Acid Conc. 98 percent , Ammonia Solution 25 percent , Oxalic acid dihydrate , Hydrochloric Acid 37 percent , Ammonium Sulphate , Sulphamic Acid , Ortho Phosphoric Acid 85 percent , Sodium Hydrogen Sulphite , Nitrate Filling Solution 5x60 ml , High Performance Ammonia Electrode Filling Solution , A Optimum Results A Fill solution for Fluoride Electrode Filling Solution , Ascobic Acid 500 gm , Lauryl Tryptose , M080-500G , Brilliant Green , M121-500G , E.C. , M127-500G, Himedia , Extran MA 02 neutral Solution , TISAB III , Bromocresol Green Indicator , Bromocresol Green Indicator 100 ml , Activated Charcoal , Ferroin Indicator Solution
Supply Of Agar Agar, Bhi , Esculin Agar, Blood Agar Base, Candida Chrom Agar, Cled Agar, Cron Meal Agar, Macconkey Agar, Mueller Hinton Agar, Nutrient Agar, Peptone Water, Sabouraud Destrose Agar, Sabouraud Dextrose Agar With Antibiotics, Simmons Citrate Agar, Triple Sugar Iron Agar, Urea Agar Base, Urea 40 Pure, Yeast Nitrogen Base, Rcm, Sample Collection Container With Spatula, Crobol Fuchsin, Cotton Blue, Crystal Violet, Diethy1 Ether, Dethy1 E Solvent, Fromalin 37 41 Percetage, Grams Lodine, Glycerol, Hydrogen Peroxide 30 Percetage, H2so4 Sulfuric Acid, Koh Potassium Hydroxide Pellets, Kovacs Indole Reagent, Lactic Acid Ar, Lactophenol Cotton Bule, Lugol S Lodine, D Mannitol, Methanol, Methylene Blue Trihydrate Practical Grade, Nigrosin, Safranine, Blood Culture Bottle 25X40ml, Blood Culture Bottle 25X30ml, Amikacin Ak 30 Mcg, Amoxyclav Amoxicillin Clavulanc Acid Amc 30 Mcg, Ampicillin Amp 10 Mcg, Azithromycin Azm 15 Mcg, Aztreonam At 30 Mcg, Bacitracin B 10 Units, Capsofungin Cas 5 Mcg, Cefazoline Cz 30 Mcg, Cefepime Cpm 30 Mcg, Cefixime Cfm 5 Mcg, Cefotaxime Cephotaxime Ctx 30 Mcg, Cefoxitin Cephoxitin Cx 30 Mcg, Ceftazidime Caz 30 Mcg, Cefuroxime Cxm 30 Mcg, Ciprofloxacin Cip 5 Mcg, Clidamycin Cd 2 Mcg, Colistin Methane Suphonate Cl 10 Mcg, Cotrimoxazole Co Trimoxazole Supha Trimethoprim Cot 25 Mcg, Erythromycin E 15 Mcg, Fluconazole Flc 25 Mcg, Furazolidone Fr 100 Mcg, Gentamicin Gen 10 Mcg, High Level Gentamicin Gentamicin Hlg 120 Mcg, Imipenem Ipm 10 Mcg, Levofioxacin Le 5 Mcg, Linezolid Lz 30 Mcg, Meropenem Mrp 10 Mcg, Micafungin Myc Range In Ug 0 002 32 Mcg Ml, Miconazole Mic 30 Mcg, Netillin Netilmicin Suphate Net 30 Mcg, Nitrofurantion Nit 300 Mcg, Norfioxacin Nx 10 Mcg, Ofloxacin Of 5 Mcg, Optochin 5 Mcg 50 Discs Vl, Oxacillin Ox 1 Mcg, Penicillin G P 10 Units, Teicoplanin Tei 30 Mcg, Tetracycine Te 30 Mcg, Tobramycin Tob 10 Mcg, Vancomycin Va 30 Mcg, Voriconazole Vrc 1 Mcg, Aso Slide, Crp Slide, Ra Slide, Widal Slide, Immerssion Oil
Supply of 3635 Modified Tryptone Soya Or Modified Soyabean Base Novobiocin Selective Supplement Macconkey Sorbitol Agar Ct Smac Tellurite Cefixim Selective Supplement Modified E.Coli O157 H7 Selective Agar Base Chromogenic Modified Phosphate Buffer Eppendorf Type Test Tube Potassium Sulfite 90 Percent
Supply of Azide Dextrose Brain Heart Infusion W 6 5 Percentage Nacl Brilliant Green Ec Lauryl Tryptose M Endo Agar Les M 7 Hr Fc Agar Macconkey Tryptone Water
Supply Of Sulphuric Acid, Suprapure Nitric Acid, Perchloric Acid, Ammonium Molybdate Tetra Hydrate, Barium Chloride, Barium Nitrate, Ammonium Molybdenum Phosphate, Potassium Chloride, Diammonium Oxalate, Arsenic Standard Solution 1000 Ppm, Zinc Standard Solution 1000 Ppm, Lead Standard Solution 1000 Ppm, Manganese Standard Solution 1000Ppm, Turbidity Standard Solution 1000 Ntu, Mbas Standard Solution 1000Ppm, Bromate Std For Ic 1000Ppm, Nitrite Standard Solution For Ic 1000Ppm, Sulphide Standard 1000Ppm, Sulphate Std Solution For Ic 1000Ppm, Cyanide Standard Solution 1000Ppm, Chloride Standard 1000Ppm, Magnesium Chloride, Colour Standard Solution 500 Unit, Wave Calibration Solution For Icp Oes, Odour Water Generater With Drain Pipe, Sample Vial For Ic, Potassium Iodide, Sodium Borohydride, Sodium Hydroxide Pellets, Sodium Acetate Trihydrate, Benzene, Hexadecane Standard, Sodium Sulphide, Sodium Chloride, Lead Carbonate, Sulphamic Acid, Sodium Sulphate, Pyridine, Ammonium Ferrous Sulphate, Silver Nitrate, Diammonium Hydrogen Phosphate, Potassium Chromate, Bromate- Bromide 0 Point 1 N Solution, Potassium Hydrogen Phosphate Dibasic, Potassium Dihydrogen Phosphate, 4- Amino Antipyrine, Disodium Hydrogen Phosphate, N, N- Dimethyl-P-Phenylenediamine Oxalate, Monocrotophos Pesticide Stanadard For Gc, Beta Hch Pesticide Stanadard For Gc, Malathion Pesticide Stanadard For Gc, Butachlor Pesticide Stanadard Gc, Ethyl Acetat Hplc Gr, Acetonitrile Hplc Gr, Acetonitrile, Dichloromethane Ar Gr, Tert.Butyl, Methyl-Ether, Hplc Gr, Tri Methyl Silyl Diazo Methane, Potassium Nitrate, Methanol, Ethanol, Acetone, Filter Paper, Watch Glass, Nesslers Cylinder, Test Tubes, Silica Crucible With Lid, Butter Sheet, Standard Flask Class A, Rotary Flask, Separating Funnel, Iodine Flask, Digital Micro Pipette, Adjustable Micro Pipettee, Syringe-Normal, Torch For Icp Oes, Syringe10 Mirolit, For Gcmsmspart No 5181 1267, Filament For Gcmsmspart No G7005 60061, Liner, Splitlesspart No 5190 3164, Septa, For Gcmsmspart No 5182 3413, Column Nut For Gcmsmspart No 5181 8830, Blue Screw Caps For Gclot No 273172, Vials For Gcmsmspart No 5188 6535, Pvc Pump Tubing Black Blackpart No 3710027200 For Icpoes, Pump Oil For Gcmsms Part No 51915851, Sodium Hypochloride Solution 1000Ppm, Ferrous Ammonium Sulphate, Syringe Filter Paper, Molybdenum Std Solun 1000 Ppm 100 Ml Icp Oes, Glass Dropper, Beaker, Ammonium Chloride Anhydrous Merk 250 Gram, Dipotassium Hydrogen Phosphate, Diphenyl Carbazide, Potassium Dichromate, Abel Flashpoint Standard, Toluene, Glass Or Polypropylene Cartridge, Aspergine Proline , Buffered Peptone Water, Esculin Azide Agar, Chromogenic Coliform Agar, Cooked Meat Medium, Deoxy Cholate Citrate Agar, Differential Reinforced Clostridial, Milk Agar, Muller Kumffer Tetrathionate , Sabrouds Dextrose , Selenite F , Tcbs Agar, Lysine Dihydrolase , Mr-Vp Medium, Hugh- Lefsion Medium, Malonate , Phenylalanine Agar, Simmons Citrate Agar, Tryptophan , Tryptone Water, Triple Sugar Iron, Urea Agar, Nitrate , Mkttn Supplementry, Coagulase, Egg Yolk Tellurite Emulsion, Oxidase Disc, Molitlity Test Medium, Indole Kovacreagent, Barrits Reagent A, Barrits Reagent B, Methyl Red, Sulphanilic Acid 0 Point 8Percent, Alpha Naphthylamine, Grams Staining, Iodine Resublimsed, Sodium Sulphite, Hydrogen Per Oxide, Agar Agar, Ferric Citrate, Salicin, Lactose, Mannitol, Dulcitol, Sucrose, Dextrose, Alkaine Saline Peptone Water, Vibrio Chromogenic Agar, Saline Lysine Decarboxylase Medium, Saline Arginine Decarboxylase Medium, Onpg, Saline Tryptophan Medium, Saline Nutrient Agar, Dichloran Rosebengal Chloramphenicol Agar, Durhams Tube, Sterile Cotton Swab Stick, Paraffin Liquid, Disposable Bag Smallsize 10X6, Disposable Bag Medium Size 14X20, Test Tube Stand, Isopropyl Alcohol, Anaerobe Indicator Tablet, Anaerobe Gas Pack, Wash Bottle, Hygiene Disinfectant Liquid, Dettol Liquid, Virosil Pharma, Screw Cap Bottle, Rimless Test Tube, Test Tube Cap, Autoclave Chemical Indicator, Autoclave Biological Indicator, Oven Chemical Indicator, Oven Biological Indicator Bacillus Atropaeus, Sterile Cellulose Nitrate Filter 0 Point 45Micron 47Mmdia Microbiological Grade, Potassium Dihydrogen Orthophosphate, Potassium Monohydrogen Orthophosphate, Magnesium Sulphate Hepta Hydrate, Ammonium Nitrate, Nacl, Potassium Sulphate, Propylene Oxide, Sodium Hypochloride 1 Perc Solution, Hydroboric Acid Ar, Manganous Sulphate Mono Hydrate, Merck, Hexane, Ar, Pentane, Ar, Methyl Tert.Butyl Ether, Ar
Supply Of Sulphuric Acid, Suprapure Nitric Acid, Perchloric Acid, Ammonium Molybdate Tetra Hydrate, Barium Chloride, Barium Nitrate, Ammonium Molybdenum Phosphate, Potassium Chloride, Diammonium Oxalate, Arsenic Standard Solution 1000 Ppm, Zinc Standard Solution 1000 Ppm, Lead Standard Solution 1000 Ppm, Manganese Standard Solution 1000Ppm, Turbidity Standard Solution 1000 Ntu, Mbas Standard Solution 1000Ppm, Bromate Std For Ic 1000Ppm, Nitrite Standard Solution For Ic 1000Ppm, Sulphide Standard 1000Ppm, Sulphate Std Solution For Ic 1000Ppm, Cyanide Standard Solution 1000Ppm, Chloride Standard 1000Ppm, Magnesium Chloride, Colour Standard Solution 500 Unit, Wave Calibration Solution For Icp Oes, Odour Water Generater With Drain Pipe, Sample Vial For Ic, Potassium Iodide, Sodium Borohydride, Sodium Hydroxide Pellets, Sodium Acetate Trihydrate, Benzene, Hexadecane Standard, Sodium Sulphide, Sodium Chloride, Lead Carbonate, Sulphamic Acid, Sodium Sulphate, Pyridine, Ammonium Ferrous Sulphate, Silver Nitrate, Diammonium Hydrogen Phosphate, Potassium Chromate, Bromate- Bromide 0 Point 1 N Solution, Potassium Hydrogen Phosphate Dibasic, Potassium Dihydrogen Phosphate, 4- Amino Antipyrine, Disodium Hydrogen Phosphate, N, N- Dimethyl-P-Phenylenediamine Oxalate, Monocrotophos Pesticide Stanadard For Gc, Beta Hch Pesticide Stanadard For Gc, Malathion Pesticide Stanadard For Gc, Butachlor Pesticide Stanadard Gc, Ethyl Acetat Hplc Gr, Acetonitrile Hplc Gr, Acetonitrile, Dichloromethane Ar Gr, Tert.Butyl, Methyl-Ether, Hplc Gr, Tri Methyl Silyl Diazo Methane, Potassium Nitrate, Methanol, Ethanol, Acetone, Filter Paper, Watch Glass, Nesslers Cylinder, Test Tubes, Silica Crucible With Lid, Butter Sheet, Standard Flask Class A, Rotary Flask, Separating Funnel, Iodine Flask, Digital Micro Pipette, Adjustable Micro Pipettee, Syringe-Normal, Torch For Icp Oes, Syringe10 Mirolit, For Gcmsmspart No 5181 1267, Filament For Gcmsmspart No G7005 60061, Liner, Splitlesspart No 5190 3164, Septa, For Gcmsmspart No 5182 3413, Column Nut For Gcmsmspart No 5181 8830, Blue Screw Caps For Gclot No 273172, Vials For Gcmsmspart No 5188 6535, Pvc Pump Tubing Black Blackpart No 3710027200 For Icpoes, Pump Oil For Gcmsms Part No 51915851, Sodium Hypochloride Solution 1000Ppm, Ferrous Ammonium Sulphate, Syringe Filter Paper, Molybdenum Std Solun 1000 Ppm 100 Ml Icp Oes, Glass Dropper, Beaker, Ammonium Chloride Anhydrous Merk 250 Gram, Dipotassium Hydrogen Phosphate, Diphenyl Carbazide, Potassium Dichromate, Abel Flashpoint Standard, Toluene, Glass Or Polypropylene Cartridge, Aspergine Proline , Buffered Peptone Water, Esculin Azide Agar, Chromogenic Coliform Agar, Cooked Meat Medium, Deoxy Cholate Citrate Agar, Differential Reinforced Clostridial, Milk Agar, Muller Kumffer Tetrathionate , Sabrouds Dextrose , Selenite F , Tcbs Agar, Lysine Dihydrolase , Mr-Vp Medium, Hugh- Lefsion Medium, Malonate , Phenylalanine Agar, Simmons Citrate Agar, Tryptophan , Tryptone Water, Triple Sugar Iron, Urea Agar, Nitrate , Mkttn Supplementry, Coagulase, Egg Yolk Tellurite Emulsion, Oxidase Disc, Molitlity Test Medium, Indole Kovacreagent, Barrits Reagent A, Barrits Reagent B, Methyl Red, Sulphanilic Acid 0 Point 8Percent, Alpha Naphthylamine, Grams Staining, Iodine Resublimsed, Sodium Sulphite, Hydrogen Per Oxide, Agar Agar, Ferric Citrate, Salicin, Lactose, Mannitol, Dulcitol, Sucrose, Dextrose, Alkaine Saline Peptone Water, Vibrio Chromogenic Agar, Saline Lysine Decarboxylase Medium, Saline Arginine Decarboxylase Medium, Onpg, Saline Tryptophan Medium, Saline Nutrient Agar, Dichloran Rosebengal Chloramphenicol Agar, Durhams Tube, Sterile Cotton Swab Stick, Paraffin Liquid, Disposable Bag Smallsize 10X6, Disposable Bag Medium Size 14X20, Test Tube Stand, Isopropyl Alcohol, Anaerobe Indicator Tablet, Anaerobe Gas Pack, Wash Bottle, Hygiene Disinfectant Liquid, Dettol Liquid, Virosil Pharma, Screw Cap Bottle, Rimless Test Tube, Test Tube Cap, Autoclave Chemical Indicator, Autoclave Biological Indicator, Oven Chemical Indicator, Oven Biological Indicator Bacillus Atropaeus, Sterile Cellulose Nitrate Filter 0 Point 45Micron 47Mmdia Microbiological Grade, Potassium Dihydrogen Orthophosphate, Potassium Monohydrogen Orthophosphate, Magnesium Sulphate Hepta Hydrate, Ammonium Nitrate, Nacl, Potassium Sulphate, Propylene Oxide, Sodium Hypochloride 1 Perc Solution, Hydroboric Acid Ar, Manganous Sulphate Mono Hydrate, Merck, Hexane, Ar, Pentane, Ar, Methyl Tert.Butyl Ether, Ar
Supply Of Chemical, Reagents And Media-Acetone, Bottle ,2500ml, Excelar or any Equivalent ,Agar agar powder 500gm/bottle ,Agarose Powder (DNA grade/Low melting), Bottle/pack, 500 gm, AR/MB grade ,Agarose Powder, Bottle/pack, 100 gm, MB ,Alkaline peptone water; 100gm/bottle ,Anaerobic Sachet, Packet,10pcs/pkt ,Andrade Indicator, Packet,100 ml/pkt ,Arabinose 250 gm/bottle ,Arginine dihydrolase agar; 500 gm/bottle ,Assay Cylinder Length: 10mm±0.1, Inner diameter: 6mm±0.1 Outer diameter: 8mm±0.1 ,Assorted Nichrome Loops Each packet contains 3 pieces of each Nichrome loop having diameter 4mm (0.01ml) 2mm (0.005ml), 1.3mm (1µl) and straight wire, double wound. ,ATCC Candida albicans 10231 ,ATCC Candida tropicalis 750 ,Autoclave tape, Pieces ,Barrit Reagent A, Bottle,100 ml/Bottle, ,Barrit Reagent B, Bottle,100 ml/Bottle, ,BET (Bacterial Endotoxin Test) water ,BHI ; 500 gm/bottle ,; 100 gm/bottle ,Bird seed agar; 100 gm/bottle ,Boric acid, Bottle/pack, 250gm, AR/LR/MB ,Buffer Capsule pH – 10, Bottle, Pack of -25, LR/AR ,Buffer Capsule pH – 10, Bottle, Pack of -10, LR/AR, ,Calcium Chloride buffer solution, Bottle/pack, 100ml, MB ,Calibrators for various kits, Pack ,Campy BAP media,Packet,100 gm/pkt, ,Candida AGAR, Practical grade ,Candida Crome Agar 500Gm/bottle ,Cetrimide agar,Packet,100 gm/pkt, ,Chemicals Consumables (Wash/Cleaning solutions/Diluents/Eluents/Column Units ) for analyzer, Pack. ,Cled Agar With Bromothymol Blue Indicator,Packet,500 gm/pkt, ,Colistin HiMIC™ Plate Kit (BMD) ,Columbia 5% Sheep Blood Agar Plate 50plts ,Control Standard Endotoxin; 10-50 EU, 50 pcs/pack ,Cork Borer 8 mm diameter ,Cornmeal Agar; 500 gm/bottle ,Cryogenic Permanent Marker, BLACK ,Cryogenic Permanent Marker, Black (Dual point) ,Cryogenic Permanent Marker, BLUE ,Cryogenic Permanent Marker, Blue (Dual point) ,Cryogenic Permanent Marker, RED ,Cryogenic Permanent Marker, RED (Dual point) ,Cryptococcus neoformans var neoformans ATCC 36556 ,Denatured Alcohol (Spirit),Bottle, 1Liter, Lab Grade ,Dermatophyte Test Medium with suppliment 1%; 500 gm/bottle ,Dextran, Bottle/pack, 100 gm, MB, ,Dextrose ; 100gm/bottle ,Diff-quik staining method (SKT for Morphology), Pack, 100tests/Pack, ,Distilled water, Bottle/can, 5 liter, Pure ,D-Mannitol, 500gm ,DNase agar with Toluidine blue; 100 gm/bottle ,dNTPs solution, Bottle/pack, 1 ml, MB, ,dNTPs solution, Bottle/pack, 5 ml, MB, ,ds DNA IIFT, Bottle/Pack, 10x05, ,EDTA, PH 8, Bottle/pack, 100 ml /50gm , MB ,EDTA, PH 8, Bottle/pack, 500 ml/ 500 gm, MB ,Elution buffer, Bottle/pack, 500 ml, MB ,Endotoxin assay kit (gel clot) ,Enriched thioglycolate ; 500gm/bottle ,Enterococcus agar base; 500gm/bottle ,Enterococcus faecalis ATCC 29212 ,Enterococcus faecium ATCC BAA-2127 ,Folin & Ciocalteu's Phenol Reagent, Bottle/pack, 500ml ,Formalin (37-41% w/v), Bottle/pack, 500 ml, AR/LR ,GC base agar; 500 gm/bottle ,GC supplement with antibiotics ,Gel Binding buffer, Bottle/pack, 100 ml, MB ,Gel Binding buffer, Bottle/pack, 500 ml, MB ,Gel Loading Buffer 10 X, Bottle, 5 X 0.5 ml approx/ variable volumes, MB ,Gel Loading Buffer 5 X, Bottle, 6 X 1 ml approx/ variable volumes, MB ,Gel Loading buffer, Bottle/pack, 6 x1ml , MB ,Geobacillius Stearothermopihilus Ampoule, Pack , 25/pack, Practical grade ,Giemsa Powder, Bottle/pack, 25 gm, Pure ,Glucose ; 100 gm/bottle ,HiViral Transport Medium, Box, 50 tube/box ,Hydrochloric Acid (99%), Bottle, 500 ml, SQ/Equivalent ,Hydrochloric Acid 1 N (36% emplura), Bottle, 500 ml, AR/MB ,Hydrogen Peroxide solution 10%, Bottle, 500 ml, LR ,Isopropyl alcohol (Lab Grade), Bottle, 1000 ml, LR ,Isopropyl alcohol (Lab Grade), Bottle, 500 ml, LR ,Klebsiella pneumoniae ATCC 700603 ,Klebsiella pneumoniae ATCC BAA-1705 ,Kovac's Indole Reagent ,Labolene solution, Can, 5 litres, ,Lead acetate paper strips 50 per pack ,Leishman's stain powder , Bottle/pack, 100gm, Pure ,Light green dye, Bottle/pack, 25 gm, Pure ,Linco T supplement, 100 gm/bottle ,Linezolid (30mcg),Vial,100 Disc/Vial ,Linezolid E test strip Pkt, 30 Strips/Pkt ,Loeffler's serum medium base, 100 gm/pack ,L-Spreader (Triple pack) Alternative to bending glass rods or pipettes, completely autoclavable, reusable ,Lysine Iron agar; 100 mg/bottle ,Lysis solution, Bottle/pack, 100-500 ml, MB ,MacConkey Agar Plate ,MacConkey Agar Plate (Triple Pack) ,MacConkey Agar RS Plate ,MacConkey Agar w/ 0.15% Salts, CV and NaCl Plate ,MacConkey Agar w/o CV, NaCl w/ 0.5% Sodium Taurocholate Plate ,MacConkey Sorbitol Agar Plate ,Malaria Ag (Pv/Pf) ICT kit; 10 tests/pack ,Mannitol Salt Agar,Packet,100 gm/pkt ,Mannitol with phenol red; 500 g/bottle ,Measles IgM ELISA kit; 48 tests/pack ,Metal Loops Holder (w/o Loop) Brass rod holder with heat resistant handle where any size of nichrome wire can be inserted. ,Metal Loops Holder CH-4 Changeable 4 mm diameter Nichrome loop with nichrome wire in Brass rod with heat resistant handle. ,Metaloop CH-2 Changeable nichrome loop embedded in Brass rod with heat resistant handle, 2 mm diameter, Nichrome wire. ,Metaloop CH-3 Changeable nichrome loop embedded in Brass rod with heat resistant handle, 3 mm diameter, Nichrome wire. ,Metaloop -SL Fixed straight nichrome wire embedded in SS rod with heat resistant handle, useful for stab culturing. ,Metaloop -SS-2 Fixed nichrome loop embedded in SS rod with heat resistant handle, size : 2.2 mm dia., calibrated to 0.005ml ,Metaloop -SS-4 Fixed nichrome loop embedded in SS rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. ,MHA with 2% glucose and 0.5 µg methylene blue 500gm/bottle ,Moeller Decarboxylase Base Agar,Packet,100 gm/pkt ,Molecular Biology grade water (Protease, DNAase, RNAase free), Bottle, 5 X 100 ml, MB ,Motility test medium; 100gm/bottle ,Nichrome Loop-D-1 Diameter : 1.3 mm, double wound, calibrated to 1.0 µl. ,Nichrome Loop-D-2 Diameter : 2 mm, double wound, calibrated to 0.005ml. ,Nichrome Loop-D-3 Diameter : 3 mm, double wound, calibrated to 0.006ml. ,Nichrome Loop-D-4 Diameter : 4 mm, double wound, calibrated to 0.01ml. ,Nitrate ; 100 gm/bottle ,NNNN-Tetramethyl-P-phenylene diamine Dihydrochloride discs ,Norfloxacin (10mcg),Vial,100 Disc/Vial ,Novobiocin disc (5mcg),Vial,100 Disc/Vial ,Nutrient agar, 500gm/bottle ,Nuclear Protein Assay Kit, Pack, 50tests/Pack ,Nucleases (DNAase/RNAase) solution, Bottle/pack, 15ml, MB ,Nucleases (DNAase/RNAase) solution, Bottle/pack, 2ml, MB ,Nutrent 500 gm ,PCR kits, Kit, 10 preps, MB ,PCR kits, Kit, 250 preps, MB ,PCR Master Mix (hot start), Kit, 250 Rx, MG ,PCR Master Mix, Kit, MB ,PCR product purification kit, Bottle/pack, 20pr, MB ,PCR product purification kit, Bottle/pack, 250pr, MB ,Petri Seal® Diameter : 0.5” X 108’, Clear. ,pH Paper Indicator (pH 1.0 -7.0), pack, 10 booklets/pack ,Phenol Red Indicator Solution, Bottle/pack, 125ml, AR/LR/SQ ,Phosphate Buffered Saline, Bottle/pack, 100 ml, MB ,Phosphate Buffered Saline, Bottle/pack, 500 ml, MB ,Phosphomolybdic acid, Bottle/pack, 500gm, AR/LR/SQ ,Phytohaemoagglutinin – M, Pack, 1 vial ,Potassium tellurite 1%, 5x5 vl/pack ,Potassium tellurite 3.5%, 5x5 vl/pack (1 ml/Vial) ,Pristinomycin (Quinupristin / Dalfopristin) ,Propylene Glycol, Bottle, 500 ml, MB ,Protein Ladder, kit, 100 lane, MB ,Protein Ladder, kit, 10lane, MB ,Protein Loading buffer, Bottle/pack, 5ml, MB ,Protein stain, Bottle/pack, 100ml, MB, ,Proteinase K solution, Bottle/pack, 500 ml, MB ,Pseudomonas aeruginosa ATCC 27853 ,PYR ,PYR Reagent,Bottle,100 ml/Bottle ,Pyruvate (cell culture grade), Bottle/pack ,RCM medium, Bottle/pack, 100 gms, LR ,Ready prepared LJ media slope, Piece ,Ready prepared Loefflers serum slope, Piece, LR ,Restriction Enzyme Hae III , Kit, 350 reactions ,Restriction Enzyme Pst I, Kit, 350 reactions ,Rheumatoid Factor LAT kit ,Sabouraud's Dextrose agar; 500 gm/bottle ,Scientific Marker, BLACK ,Scientific Marker, BLUE ,Scientific Marker, GREEN ,Scientific Marker, RED ,SDA with chloramphenicol and cycloheximide; 500 gm/bottle ,SDA with chloramphenicol; 500 gm/bottle ,Selenite F selenite supplement; 500 g/bottle ,Sheep Blood Agar Plate 50plts ,SIM (Sulphur Indole Motility) supplement ,Sodium biphospahate, 500 gm AR ,Sodium Deoxycholate 100gm ,Sodium Deoxycholate 25gm ,Sodium Dodecyl Sulphate, Bottle/pack, 25 gms, MB, ,Sodium Hydroxide buffer, Bottle/pack, 10x500ml, MB ,Sodium Taurocholate 500gm ,Sodium Taurocholate, Certified 500gm ,Sodium Tauroglycocholate, bacteriological grade 500gm ,Sodium Thioglycollate,Packet,100 gm/pkt ,Soft soap, ,Sorbitol; 500 gm/bottle ,StabiFlexiLoop Plus - 2 Sterilized flexible, calibrated loop with a streaker / stabber tip, size: 2.0mm diameter, calibrated to 0.005 ml. ,StabiFlexiLoop Plus - 4 Sterilized flexible, calibrated loop with a streaker / stabber tip, size: 4.4mm diameter, calibrated to 0.01 ml. ,Staphylococcus aureus subsp. aureus ATCC 25923 ,Staphylococcus epidermidis ATCC 12228 ,Sterile Disc,Vial,100 Disc/Vial ,Sterile Disposable Forceps ETO Sterilized,length 12.5 cm, individually packed in BOPP Pouch ,STET buffer, Bottle/pack, 500 ml,MB, ,Straight wire (Nichrome) Suitable for stab inoculation. ,Streptococcus agalactiae ATCC 13813 ,Streptococcus pneumoniae ATCC 6303 ,Streptococcus pyogenes ATCC 19615 ,Stuart transport medium; 100 gm/bottle ,Surgical spirit, Bottle,500 ml/1 litre ,Synaptophysin, Pack, 100 test ,Syphilis Ab ICT kit; 10 tests/pack ,Syphilis RPR Slide flocculation Test kit ,TBE buffer, Bottle/pack, 100mg, MB ,TBE buffer, Bottle/pack, 500gm, MB ,TCBS medium, 100 gm/pack ,TE Buffer, Bottle/pack, 500 ml,MB ,Teepol Detergent Liquid, Can,5 litres ,Tetrathionate medium; 100 gm/bottle ,Therapeutic Drug Monitoring kit, Pack ,Toxoplasma Ab ELISA kit; 96 tests/pack ,Trichloroacetic acid, Bottle/pack, 500 gm, SQ/Equivalent/AR ,Tris-Cl buffer, Bottle/pack, 100gm/ 100 ml,MB ,Tris-Cl buffer, Bottle/pack, 100gm-500gm/ 100-500 ml,MB ,Tris-EDTA buffer, Bottle/pack, 500gm/500 ml,MB ,TTC Solution 1% (10 ml per vial) ,Urea 40% (5 ml per vial) ,UTI Agar SM1353-5X100ML ,X Factor (50 discs / vl) ,X+V Factor (50 discs / vl) ,V Factor (50 discs / vl) ,V.C.N. supplement, 100 gm/bottle ,V.C.N.T. supplement, 100 gm/bottle ,Vanclo T supplement,100 gm/bottle ,Water Test kit to identify coliform organisms, Vibrio, salmonella from water samples, Piece, ,WIDAL Tube agglutination Test kit ,Xylose Lysine Deoxycholate Agar?(XLD Agar) 100gm ,Glycerine 500ml, pack ,Soap solution with dispenser 500 ml ,Haemophilus test agar base 500gm ,Haematin growth suppliment 5vails ,H.influenzae ATCC 47147 (2sticks) ,H.influenzae ATCC (2sticks)
