"नये भारत का नया Tender Portal"
Gem Bids For Media, Fraser Broth, Fraser Secondary Enrichment, Listeria Ottaviani Agosti Agar Basr, L Monodifferential Hiveg Agar Base, Tryptone Soya Yeastextract Broth, Sheep Blood Agar Plate, Alkalinepeptone Water, Tcbs Agar, Hichrome Vibrio Agar, Buffered Peptone Water, Modified Semi-solidrappaport Vassiliadis Agar, Xld Agar, Macconkey Agar, Mr-vp, Motility Test Medium, Selenite Cystinehiveg Broth, Bismuth Sulphite Agar, Hichromechromogenic Coliform Agar, Hektoen Enteric Hivegagar, Yeast Extract Agar, Eosin Methylene Bluelactose Agar Medium, Brilliant Green Bile Broth, Sterile Mineral Oil, Triclogel Dispenser Bottle With Pump500 Ml
Gem bids for Procurement, Buffer Solution Ph4.00 Crm, Potassium Chloride Crm, Sodium Chloride Crm, Potassium Bi Iodatecrm, Hydrazinesulphate, Ammonium Hydroxide, Sodium Hydroxide, Sodium Iodide, Potassium Hydroxide, Potassium Iodide, Potassium Chromate, Ferroin Indicator, Starch Soluble, Sodium Azide, Mangnous Sulphate, Glucose, Glutamicacid, Ferric Chloride, Sulphuric Acid, Sodium Thiosulphate, Dipotassium Hydrogen Phosphate, Oxalic Acid, Ethanol, Sodium Hypochloride, Ammonium Chloride, Hydrochloricacid, Nitric Acid, Magnesium Chloride, Cod Vials, Lauryltryptose, Brilliant Green Bile Broth, E-Coli Broth, Sulphanilamide, Sodium Oxalate, Ferrous Ammoniumsulphate, Potassium Permanganate, Hand Sanitiser, Conductivity Electrode, Ph Electrode, Ph Meter, Filterpaper, Silt Tube 5Ml, Silt Tube 2Ml, Glass Funnel, Redmercury Thermometer, Tissue Paper, Potash Alum, Laboratory Test Sieves, Enamelled Bowl, China Clay Bowl, Metallic Bottle, Enamel Bucket With Lid, Silica Gel, Enameltray, Micropipette 0.1-1 Ml, Micropipette 1-5 Ml, Micropipette 1-10 Ml, Micropipette Tip 0.1-1 Ml, Micropipette Tip 0.5-10 Ml, Dropper Bottle, Washing Jetbottle, Aspirator Bottle, Tray, Micropipette Stand, Plasticbottle 100 Ml, Plastic Bottle 250 Ml, Magnet Retriever, Burette Stand, Pipette Controller, Durham Tube, Beaker100 Ml, Beaker 50 Ml, Beaker 25 Ml, Glass Burette 25 Ml, Bod Bottle, Glass Bottle 125 Ml, Glass Bottle 250 Ml, Glass Bottle 500 Ml, Glass Bottle 1000 Ml, Glass Rod, Volumetric Flask 250 Ml, Measuring Cylinder 100 Ml, Pipette 5Ml, Aluminium Foil, Spatula 6 Inch, Spatula 8 Inch, Spatula 10 Inch, Dust Bin With Lid, Plastic Bucket /Bid Number: Gem/2025/B/6390166* /Dated: 05-08-2025 & & / Bid Document1 / 52
Gem Bids For Chemical, Lauryl Tryptose Broth, Brilliant Green Bile Broth 2percent, Ec Broth, Miu Medium, Bile Esculin Azide Agar, Brainheart Infusion Broth, Parafilm M, Antiseptic Spray
Gem Bids For Modified Charcoal Cefoperazone Deoxycholate Agar Plate, Hektoen Enteric Agar, Mannitol Salt Agar Base Granulated, Emb Agar, Msa, Plet, Plet Selective Suppliments, Ssagar, Deoxycholate Agar, Camphylobacter, Camphylobacter Suppliments Park And Sanders Selective, Brucella Agar, Brucella Suppliments Skirrow Selective, Brain Heart Infussion Agar Media Granulated, Listeriaselective Agar Base, Listeria Selective Agar Base Hiancselective Supplements, Robertsons Cooked Meat Media, Reinforced Clostridial Agar Granulated, Tryptose Sulphitecycloserine Agar Base Granulated, Peptone Water, Agaragar, Gram Staining Kit, Spore Staining Kit, Giemsa Stain, Mcfadyean Reagent, Anaerobic Agar, Xld Agar, Bismuthsulphite Agar, Selenite F Broth, Tetrathionate Brilliantgreen Bile Broth, Rappaport Vassiliadis Soya Broth, Trypticase Soy Broth
Gem Bids For Culture Media, 14541 Palcam Aloa Agar Tsc Agar Sb Medium Mineral Modified Glutamate Medium Bismuth Sulphite Agar Onpg Broth Kings Medium B Base Shigella Broth Base Sulfite Indole Motility Agar Differential Reinforced Clostridial Broth Base Chromogenic Coliform Agar Soyabean Casein Digest Medium Buffered Peptone Water Potato Dextrose Agar Alkaline Peptone Water Brilliant Green Bile Broth Myp Agar Base Chrom Agar Vibrio Bromcresol Purple Bcp Dextrose Broth
Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G
Supply of Hydrochloric Acid , Conc. Sulphuric acid , Nitric Acid , Perchloric Acid , Potassium dihydrogen phosphate , Magnesium sulphate heptahydrate , Gluconic acid , Boric acid , Copper sulphate pentahydrate , Molybdenum trioxide , Ferric chloride , HDTMA , Glycerol , Sucrose , Di potassium hydrogen phosphate , Sodium molybdate , Calcium carbonate , two four dinitrophenyl hydragine , Tris HCL buffer , Lead nitrate , Nutrient agar , Gram stain kit , Hi assorted biochemical test kit , Sodium bicarbonate , Picric acid liquid , Glycine , ACC , Slide , Normal glass spreader , Test tube , Ethanol , Test tube rack , PTFE Syringe Filter , Cover Slip , Purple nitrile gloves , Lauryl Tryptose Broth , Brilliant green lactose bile broth , Eosine Methylene blue , Starch Powder , Ethylene diamine tetra acetic acid , Ammonium Solution , Ammonium Hydroxide , Eriochrome Black T , Silver Sulfate , Sulphamic Acid , Mercuric Sulfate , Ferroin Indicator , Calcium Chloride , Magnesium Sulfate , Sodium Azide , Volumetric Flask I , Volumetric Flask II , Volumetric Flask III , Conical Flask I , Conical Flask II , Reagent Bottle , Pipette I , Pipette II , Pipette III , Wash Bottle , Dropper , Pipette sucker , Gloves , Potassium Dichromate , Ferrous Ammonium Sulfate , Diphenylamine , Orthophosphoric acid , Sodium Fluoride , Potassium permanganate , Sodium Hydroxide , Sodium Carbonate , Bromocresol green , Methyl red , Potassium Dihydrogen Phosphate , two four Dinitrophenol , Sodium Bicarbonate , Ammonium molybdate , Ascorbic acid , Antimony Potassium tartrate , Activated charcoal , Calcium chloride , Sulphamic acid , Silver sulphate , Mercuric sulphate , Ammonium chloride , Eriochrome black T , Ethyl alcohol , Phenolphthalein indicator , Potassium phthalate , Methyl alcohol , Tissue Roll , Ammonium hydroxide
Supply of Buffer solution. pH-4.0, CRM, As per ISO 17034 , Buffer solution. pH-7.0, CRM, As per ISO 17034 , Buffer solution. pH-9.0, CRM as per ISO 17034 , Potassium chloride solution CRM, As per ISO 17034 , Ammonia CRM, As per ISO 17034 , BOD Standard CRM, As per ISO 17034 , Potassium hydrogen di-iodate CRM Solution, As per ISO 17034 , Glacial Acetic Acid 99 percent , Nitric Acid 69 percent suprapur , Magnesium Chloride , Manganese II, Sulphate monohydrate , Silver Nitrate , Sodium Iodide , Sodium Hydroxide , Calcium Chloride Fused , Barium Chloride Dihydrate , Sulphuric Acid Conc. 98 percent , Ammonia Solution 25 percent , Oxalic acid dihydrate , Hydrochloric Acid 37 percent , Ammonium Sulphate , Sulphamic Acid , Ortho Phosphoric Acid 85 percent , Sodium Hydrogen Sulphite , Nitrate Filling Solution 5x60 ml , High Performance Ammonia Electrode Filling Solution , A Optimum Results A Fill solution for Fluoride Electrode Filling Solution , Ascobic Acid 500 gm , Lauryl Tryptose Broth, M080-500G , Brilliant Green Bile Broth, M121-500G , E.C. Broth, M127-500G, Himedia , Extran MA 02 neutral Solution , TISAB III , Bromocresol Green Indicator , Bromocresol Green Indicator 100 ml , Activated Charcoal , Ferroin Indicator Solution
Supply Of Agar Agar, Bhi Broth, Bile Esculin Agar, Blood Agar Base, Candida Chrom Agar, Cled Agar, Cron Meal Agar, Macconkey Agar, Mueller Hinton Agar, Nutrient Agar, Peptone Water, Sabouraud Destrose Agar, Sabouraud Dextrose Agar With Antibiotics, Simmons Citrate Agar, Triple Sugar Iron Agar, Urea Agar Base, Urea 40 Pure, Yeast Nitrogen Base, Rcm, Sample Collection Container With Spatula, Crobol Fuchsin, Cotton Blue, Crystal Violet, Diethy1 Ether, Dethy1 E Solvent, Fromalin 37 41 Percetage, Grams Lodine, Glycerol, Hydrogen Peroxide 30 Percetage, H2so4 Sulfuric Acid, Koh Potassium Hydroxide Pellets, Kovacs Indole Reagent, Lactic Acid Ar, Lactophenol Cotton Bule, Lugol S Lodine, D Mannitol, Methanol, Methylene Blue Trihydrate Practical Grade, Nigrosin, Safranine, Blood Culture Bottle 25X40ml, Blood Culture Bottle 25X30ml, Amikacin Ak 30 Mcg, Amoxyclav Amoxicillin Clavulanc Acid Amc 30 Mcg, Ampicillin Amp 10 Mcg, Azithromycin Azm 15 Mcg, Aztreonam At 30 Mcg, Bacitracin B 10 Units, Capsofungin Cas 5 Mcg, Cefazoline Cz 30 Mcg, Cefepime Cpm 30 Mcg, Cefixime Cfm 5 Mcg, Cefotaxime Cephotaxime Ctx 30 Mcg, Cefoxitin Cephoxitin Cx 30 Mcg, Ceftazidime Caz 30 Mcg, Cefuroxime Cxm 30 Mcg, Ciprofloxacin Cip 5 Mcg, Clidamycin Cd 2 Mcg, Colistin Methane Suphonate Cl 10 Mcg, Cotrimoxazole Co Trimoxazole Supha Trimethoprim Cot 25 Mcg, Erythromycin E 15 Mcg, Fluconazole Flc 25 Mcg, Furazolidone Fr 100 Mcg, Gentamicin Gen 10 Mcg, High Level Gentamicin Gentamicin Hlg 120 Mcg, Imipenem Ipm 10 Mcg, Levofioxacin Le 5 Mcg, Linezolid Lz 30 Mcg, Meropenem Mrp 10 Mcg, Micafungin Myc Range In Ug 0 002 32 Mcg Ml, Miconazole Mic 30 Mcg, Netillin Netilmicin Suphate Net 30 Mcg, Nitrofurantion Nit 300 Mcg, Norfioxacin Nx 10 Mcg, Ofloxacin Of 5 Mcg, Optochin 5 Mcg 50 Discs Vl, Oxacillin Ox 1 Mcg, Penicillin G P 10 Units, Teicoplanin Tei 30 Mcg, Tetracycine Te 30 Mcg, Tobramycin Tob 10 Mcg, Vancomycin Va 30 Mcg, Voriconazole Vrc 1 Mcg, Aso Slide, Crp Slide, Ra Slide, Widal Slide, Immerssion Oil
Supply of 3635 Modified Tryptone Soya Broth Or Modified Soyabean Bile Broth Base Novobiocin Selective Supplement Macconkey Sorbitol Agar Ct Smac Tellurite Cefixim Selective Supplement Modified E.Coli O157 H7 Selective Agar Base Chromogenic Modified Phosphate Buffer Eppendorf Type Test Tube Potassium Sulfite 90 Percent
