"नये भारत का नया Tender Portal"
Request a call back

Latest Tenders for cell culture

Total 595 tenders found
#TBR: 35710655 New

Education And Research Institutes

  • Kerala
  • Due On: 15 Nov, 2025 (15 Days Left)

Gem Bids For Pcr Workstation Rack, Silicon Sealing Mat For Plates, Nonskirted 96 Wells Standard Profile Pcr Plate, Spinot Tmmagnetic Stirrer Hot Plate, Midi Submarine Electrophoresisunit, Gel Caster For Submarine Electrophoresis Unit, Minidual Vertical Electrophoresis Unit, Hooklokmicrocentrifuge 2 Ml Tube, Hooklok Microcentrifuge 1.5ml Tubes, Pcr Tubes 0.2, Cell Culture Tube With Filterscrew Cap Sterile 50 Ml Tubes, Cell Culture Tube With Filterscrew Cap Sterile 15 Ml Tubes, Planton Tissue Culturecontainer, L Shaped Spreader Sterile Ps, Cryo Box Pc, Cryo Cube Box Pp, Cryo Cube Box 96 Well, Kim Wipes, Micro Tips Bulk Pack 10 Ref, Micro Tips Bulk Pack Tipsyellow 200, Micro Tips Bulk Pack 1000 Ref Blue, Thermoconductive Rack, Ice Tray Without Lid Pur, Coplin Jar, Screw Cap Oakridge Centrifuge Tube Round Bottom Pp 30ml, Bottle Stopcock, Pcr Tubes 0.5, Pcr Strips, 1.5ml Tube Sterile, 2 M L Tube Sterile, 0.5 Ml Tubesterile, Spinwin Cliklok Microcentrifuge Tube Amber 0.5, Spinwin Cliklok Microcentrifuge Tube Amber Amber 1.5, Spinwin Cliklok Microcentrifuge Tube Amber Amber 2, Tough Tags, 20 C Mini Cooler With Gel Filled Cover, Drying Rack Abs Pc

Ref. Document
View Tender
#TBR: 35714357 New

Education And Research Institutes

  • Kerala
  • Due On: 17 Nov, 2025 (17 Days Left)

Gem Bids For All, All Trans Retinoic Acid, 1 1 1 3 3 3 Hexafluoro 2propanol 99 Plus Percentage, Albumin From Bovineserum, Dimethyl Sulfoxide, Chloroform, Isopropanol, Chloroform 2.5 Ltr, Acetone Ep2.5ltr, Dmso, Sodium Bicarbonate Cell Culture

Ref. Document
View Tender
#TBR: 35706717 Live

Education And Research Institutes

  • Orissa
  • Due On: 14 Nov, 2025 (14 Days Left)

Gem Bids For Cell Cultured Treated Sterile 175 Cc Cell Culture Flask Withfilter Closure, Cell Culture Treated Sterile 225 Cc Cell Cultureflask With Filter Closure, Cell Culture Treated Sterile 75 Cccell Culture Flask With Filter Closure, Quick Release Vacuumfiltration System Polyethersulfone Membrane, Mammaliancell Culture Grade Gmem With L Glutamine Without Tryptosephosphate Broth And Sodium Bicarbonate Powder Suitablefor Cell Culture Powder

Ref. Document
View Tender
#TBR: 35697833 Live

Health Services And Equipments

  • Maharashtra
  • Due On: 06 Nov, 2025 (6 Days Left)

Gem Bids For Acetylcysteine 200mg Per Ml Inj 2ml Ampoule Acyclovir500 Mg Inj Adenosine Inj 3mg Per Ml 2ml Amp Adrenalinebi Tartarate Inj 1 Is 1000 W By V 1ml Amp Amikacinsulphate 500 Mg Inj 2ml Vial Amiodarone 50 Mg Per Ml Inj3ml Amp Amoxycillin Sodium 1gm Plus Clavulanic Acid200mg Per Vial Inj Anti D Rho D Human Immunoglobulinpolyclonal Or Monoclonol 300mcg Inj Ascorbic Acid 500mgper 5ml 5ml Amp Inj Rabies Antiserum 1500 Iu Per 5ml Injim And Sc Rabies Vaccines Human Cell Culture Potency Ofnlt 2 Point 5 Units Per Vial Ip For Id Use Tissue Culture Inj1ml Vial Atracurium Besylate 10mg Per Ml Inj 2 Point 5mlamp Atropine Sulphate 0 Point 6 Mg Per Ml Inj 1ml Amp Azithromycin 500mg 100mg Per Ml Inj 5ml Vial Amphotericin B 50mg Per 10 Ml Lyposomal Inj Bupivacainehydrochloride 50mg Per 10ml 5mg Per Ml Inj 20ml Vial Bupivacaine Hcl Heavy 5 Mg Plus Dextrose Monohydrate80mg Per Ml Inj 4ml Amp Caffeine Citrare 500mg Calciumgluconate 10 Percentage W By V Inj 10 Ml Amp Carboprost250mcg Inj 1ml Amp Cefotaxime Sodium 1gm Inj Ceftriaxone Sodium 1gm Inj Cyclophosphamide 500mg Inj Dexamethasone 4mg Per Ml Inj Dexmedetomidine100mcg Per Ml Inj 1ml Amp Diclofenac 75mg Per Ml Inj1ml Amp Dicyclomine 10mg Per Ml Inj 2ml Amp Dobutamine Hcl 250mg Per 5ml Inj Doxophyllin 100 Mg Drotaverine Hcl 40mg Per 2ml Inj Dopamine Hcl 40mgper Ml Inj 5ml Amp Erythropoitin 4000 Iu Inj Pfs Ethamsylate 125mg Per Ml Inj 2ml Amp Heparin Lowmolecular Weight 60mg Per 0 Point 6ml Inj Pfs Enoxaparin Fentanyl 50mcg Per Ml Inj 2ml Amp Frusemide 10mg Perml Inj 2ml Amp Glycopyrrolate 0 Point 2mg Per Ml Inj 1mlamp Haloperidol 5mg Per Ml Inj 1ml Amp Humanchorionic Gonadotropin 5000 Iu Immunoglobulin Humannormal 5 Percentage For Intravenous Use 5gm Ivig 100ml Bid Number Gem2025b6788395 Dated 22-10-2025 Bid Document1 66 0 0 Vial, Insulin Highly Purified Human Neutral Inj Regular 40 Iuper Ml 10ml Vial, Hyaluronidase 1500 Iu Powder Forsolution For Injection 2ml Vial, Hydrocortisone Sodiumsuccinate 100mg Per Vial Inj, Iron Sucrose 20mg Per Ml 5mlamp Inj, Ketamine Hydrochloride Inj 50mg Per Ml 10ml Vial, Lignocaine 2 Percentage With Adrenaline 1 Is To 10000 Iuinj 30ml, Levetiracetam 100mg Per Ml Inj 5ml Vial, Lignocaine 2 Percent Inj 30ml Vial, Lorazepam 2mg Per Mlinj 2ml Amp, Labetalol Hcl 5mg Per Ml 4ml Amp, Lungsurfactant For Intratrecheal Instillation Natural Bovine 5mlminimum Labelled Shelf Life 18 Month, Magnesium Sulphate50 Percent W By V Inj 2ml Amp, Methotrexate 25mg Inj, Vitamin K Inj Menadione 10mg Per Ml Inj 1ml Amp, Mephentermine 30mg Per Ml Inj 10ml Vial, Meropenam 1gm Inj, Methyl Prednisolone Sodium Succinate 500mg Pervial Inj, Metoprolol 1mg Per Ml Inj 5ml Amp, Midazolam1mg Per Ml Inj 5ml Vial, Multivitamin Nfi Inj 10ml Amp Eachml Contain Vit B1 Ip 10mg Vit B2 Ip 2mg Vit B6 Ip 2mgniacinamide Ip 100mg D Panthenol Ip 5mg, Neostigminemethyl Sulphate 0 Point 5 Mg Per Ml Inj 1ml Amp, Nitroglycerine 5mg Per Ml Inj 5ml Amp, Noradrenaline 2mgper Ml Inj 2ml Amp, Ondansetron 2mg Per Ml Inj 2ml Amp, Oxytocin 5 Iu Per Ml Inj 1ml Amp, Octreotide 100mcg Perml Inj 1ml Amp, Paracetamol 150mg Per Ml Inj Iv Use Only2ml Amp, Pentazocine Lactate 30mg Per Ml Inj 1ml Amp, Pheniramine Maleate 22 Point 75 Mg Per Ml Inj 2ml Amp, Phenytoin Sodium 50mg Per Ml Diphenyl Hadantoin Sodiuminj 2ml Amp, Vitamin K Inj 0 Point 5mg Inj Phytonadione 0point 5ml Amp, Piperacilin 4gm Plus Tazobactum 0 Point 5mg Inj, Potassium Chloride 150mg Per Ml Inj 10ml Amp, Propofol 1 Percent Iv 10 Ml Vial, Rituximab 500mg Per50ml, Sodium Bicarbonate 7 Point 5 Percent W Per V Inj10ml Amp, Sodium Valproate 100mg Per Ml Inj 5ml Vial, Water For Injection 5ml Amp Sterile, Streptokinase 15 Lac Iu Inj, Succinyl Choline Chloride 50mg Per Ml Inj 10ml, Tetanus Toxoid Inj 0 Point 5ml Amp, Tramadol 50mg Per Mlinj 2ml Amp, Tranexamic Acid 500mg Per 5ml Inj, Thiaminevitamin B1 200mg Per 2ml Inj, Vancomycin Hcl 500mg Inj, Vecuronium Bromide 4mg Inj, Voriconazole 200mg Inj200mg Per Vial, Vasopressin 20 Percent Per Ml Inj, Albumin Human 20 Percent Inj 100ml Bottle, Amino Acid 10percent 500 Ml Bottle, Ciprofloxacin I V 100 Ml Bottle, Dextrose 10 Percent I V 500 Ml Bottle, Dextrose 5 Percentwith Sodium Chloride 0 Point 9 Percent W By V Ip Dns I V500 Ml Bottle, Fluconazole 100ml Bottle Iv Use, Hydroxyethyl Starch I V 200 By 0 Point 56 Percent 500 Mlbottle, Linezolide I V 300ml Bottle, Mannitol I V 20 Percent100 Ml Bottle, Moxifloxacin 400mg 100ml, Metronidazole Iv 100 Ml Bottle, Multiple Electrolytes And Dextrose Inj Type1 Usp Bottle Pediatric Maintenance Sol With 5 Percentdextrose Inj 500 Ml Bottle, Paracetamol 10mg Per Ml Inj100ml Bottle, Ringers Lactate Compound Sol Iv Cacl Ip 0point 27gm Kcl Ip 0 Point 40gm Nacl Ip 0 Point 600gm Sodlactate Ip 0 Point 320gm Water For Inj Qs 500 Ml Bottle, Sodium Chloride I V 0 Point 9 Percent 100 Ml Bottle, Sodium Chloride I V 3 Percent 100ml Bottle, Sodiumchloride I V 0 Point 9 Percent 500 Ml Bottle

1.47 Crore
View Tender
#TBR: 35632510 Live

Education And Research Institutes

  • West Bengal
  • Due On: 05 Nov, 2025 (5 Days Left)

Gem Bids For Equipment For Cell Culture With Hypoxia Chamber Incubator

Ref. Document
View Tender
#TBR: 35618401 Live

Education And Research Institutes

  • Uttaranchal
  • Due On: 04 Nov, 2025 (4 Days Left)

Gem Bids For Iron Chloride Reagent Grade Sulfanilamide 98 Sodiumsalicyclate Wrapup Alluminium Foils 18 Micron 70 Meter 4pack Kimwipes 60 Box Cs Cryo Tags For 1 5ml Tubes 1000roll 1 5 Ml Boil Proof Microtubes Clear Non Pyrogenic Rnasednase Free 500 Tubes Unit 10 Unit Sper Case 200 Uluniversal Tip Non Sterile Low Retention Bulk 1000 Pk 10000cs Sodium Azide Sq 4 Amino Anti Pyrine Sq Phenol Sq Benzoic Acid Sq Glacial Acetic Acid Acs Grade 1050 Kgm3 Dimethyl Sulfoxide Dmso Acs 3 N Morpholinopropanesulfonic Acid Mops Glass Centrifuge Tube Stainless Steel Test Tube Rack Quantitative Filter Paper Total Protein Test Kit Albumin Test Kit Bromocresol Greenend Point Assay Kit Triglycerides Gpo Pap End Point Assaykit Ast Aspartate Transaminase Modified Uv Ifcc Kineticassay Kit Alt Alanine Transaminase Modified Uv Ifcckinetic Assay Kit Glucose Assay Kit God Pod Alkalinephosphatase Pnpp Assay Kit N Succinyl Ala Ala Pro Phe Pnitroanilde Na Benzoyl L Arginine 4 Nitroanilidehydrochloride L Leucine P Nitroanilide Sodium Cholatehydrate 4 Nitrophenyl Palmitate Biuret Reagent Epinephrine Screw Cap Sample Bottle Polypropylene 500ml Micro Centrifuge Tubes 0 6ml Micro Centrifuge Tubes 15ml Micro Centrifuge Tubes 2ml Pcr Tube Rack Withhinged Lid 96 Places 0 2ml Pcr Tube Strips With Flat Caps 01ml 8 Tubes Strips Pcr Tube With Flat Caps 200ul Universaltips Non Sterile Low Retention Bulk 10ul Universal Tips Nonsterile Low Retention Bulk 1ml Universal Tips Non Sterilelow Retention Bulk Parafilm 4 Inches 125 Meters 5 Mlsyringes With Needle Needles For Syringe 23 Gauge Alamar Blue Resazurin Sodium Salt Cell Culture Testedc12h6nnao4 Mw 251 17 Leibovitz S L 15 Medium W Lglutamine W O Sodium Bicarbonate Antibiotic Antimycoticsolution 100x Liquid Endotoxic Tested Sodium Pyruvate Bid Number Gem2025b6789146 Dated 14-10-2025 Bid Document1 122 1 1 Solution 100mm, Mem Non Essential Amino Acids Solution100x, 1n Hydrochloric Acid Solution Sterile Filtered 10 X 20ml, Parafilm M Sealing Film 100mm 38mtr Dimension Mm132x135x112, Syringe Driver Filters Cellulose Acetatehydrophilic Membrane Pore Size 0 22um 25mm Diamterewith Prefilter Sterile, Syringe Driver Filters Cellulose Acetatehydrophilic Membrane Pore Size 0 45um 25mm Diamterewith Prefilter Sterile, Sterifast In 500ml Dispenser Bottle Wpump, Hishield Hand Wash In 1 Lit Can Pack, Germitol 5 Litcan Pack, Steriswift Disinfectant Wipes Size 6x8, Glycerol 12 3 Propanetriol For Molecular Biology, Calcium Chlorideanhydrous Cell Culture Tested, Luria Bertani Agar Miller, Tryptone Soya Agar Casein Soyabean Digest Agar, Tryptone Soya Broth Soyabean Casein Digest Medium, Magnesium Chloride Anhydrous Grade 100g Molecularbiology Grade, Polyethylene Glycol Average Mol Wt 3 350250g, Colchicine 1g, Nuclease Free Water 10x50ml Depctreated For Molecular Biology, Glutaraldehyde Solution 25 Inh2o, Whatman Quantitative Filter Papers Ashless Grade 5891 Black Ribbon Circles Diam 185mm Pack Of 100, Acetic Acidglacial 100 Anhydrous For Analysis Emsure, Filter Tip Inrack 200ul 96 Tips X 10 Racks X 10 Packs Box, Filter Tip Inrack 1000ul 96 Tips X 6 Racks X 10 Packs Box, Serologicalpipette Crystal Grade Polystyrene Ps Sterile Individuallypacked 5ml Pieces Sleeve 1 Pieces Inbox 100 Pieces Case400, Serological Pipette Crystal Grade Polystyrene Pssterile Individually Packed 10ml Pieces Sleeve 1 Piecesinbox 100 Pieces Case 400, Serological Pipette Crystalgrade Polystyrene Ps Sterile Individually Packed 25mlpieces Sleeve 1 Pieces Inbox 100 Pieces Case 400, Cryovialexternally Threaded Clear Total Volume 1 2ml Packed In 50500 Sterile, Alkalinity Total For 50 Tests, Calcium Hardnessfor 50 Tests, Hardness For 50 Tests, Magnesium For 50tests, Nitrate For 50 Tests, Nitrate N For 50 Tests, Nitratenano2 For 50 Tests, Ph Phenol Red For 50 Tests, Phosphate Lr For 50 Tests, Potassium For 50 Tests, Sulfatefor 50 Tests, Staphylococcus Aureus Atcc 25923, Staphylococcus Aureus Subsp Atcc 29213, Staphylococcusaureus Subsp Atcc 43300, K Pneumoniae Atcc 700603, Kpneumoniae Atcc Baa 1705, E Coli Atcc 25922, Coagulase Plasma From Rabbit, Tryptone Broth W 10 Nacl, Baird Parker Agar Medium, Alkaline Peptone Water, Ecbroth, Ampicillin Dextrin Agar Base, Potato Dextrose Agar, Potato Dextrose Broth, Levine Eosin Methylene Blue Agarmedium, Glucose Peptone Agar, Chloramine T Hydrate, Oxytetracycline Dihydrate, D Galactose, D Mannitol, Dmannose, D Xylose, Inositol, Dulcitol, L Rhamnosemonohydrate, D Sorbitol, D Raffinose Pentahydrate, Dtrehalose Dihydrate, Adonitol, D Salicin, D Melibiosemonohydrate, Esculin Fermentation Broth, Gelatin Hi Lr, Sodium Hydroxide, Simon Citrate Agar, Sm Agar, Simmedium, Starch Agar, Indole Nitrate Medium, Urea Agarbase, Glucose Of Medium, Phenol Red Broth Base, Mr Vpmedium Buffered Glucose Broth, Dnase Test Agar W Methylgreen, Triple Sugar Iron Agar, Ornithine Decarboxylasebroth, Lysine Decarboxylase Broth, Arginine Dihydrolasebroth, Glycerol Hi Ar, Tryptone Soya Broth Soyabeancasein Digest Medium, Esculin Agar, Muller Hinton Agar, Gram Stains Kit, Durham Tubes, O Gene Ruler 1kb Dnaladder, O Gene Ruler 100bp Dna Ladder Plus, Taq Dnapolymerase Recombinant 5 U Ul, Dntp Mix 10mm Each, Water Nuclease Free Molecular Biology Grade, 6x Loadingdye Solution, Lysozyme, Storage Vial Self Standing Pp Withhdpe Closure, Cryo Babies, Laser Cryo Babies, Tough Tags    //bid Details2 / 122, Spinwin Tube Conical Bottom Pp With Hdpe Closure 15 Ml, Slid Box Ps, Autoclavable Bags Pp, Sample Bags Ldpe, Beaker Pmp, Beaker Pp, Sodium Hippurate, Acetone, 1butanol, Ninhydrin, Tagatose, Dnase Test Agar, Nutrientgelatin Agar, Triple Sugar Iron Agar, Phenol Red Dextrosebroth, Phenol Red Sucrose Broth, Phenol Red Lactose Broth, Phenol Red Maltose Broth, Phenol Red Mannitol Broth, Phenol Red Dulcitol Broth, Phenol Red Salicin Broth, Phenolred Sorbitol Broth, Phenol Red Raffinose, Phenol Redarabinose Broth, Phenol Red Xylose Broth, Phenol Redstarch Broth, Phenol Red Inositol Broth, Phenol Redgalactose, Phenol Red Rhamnose, Phenol Red Adonitol, Phenol Red Trehalose, Cc Mount Tissue Mounting Medium, Weigerts Iron Hematoxylin Kit, Silver Stain Kit, Ermamicrotome Blades

16.02 Lacs
View Tender
#TBR: 35625405 Live

Security Services

  • Uttar Pradesh
  • Due On: 05 Nov, 2025 (5 Days Left)

Gem Bids For Procurement, Bid Number Gem2025b6780219 Dated 14-10-2025 Bid Document1 52 1 1 Lignocaine Hcl 2per With Adrenaline Glass Cartridge Of1point8 Ml, Inj Lignocaine Hcl 2per With Adranaline30ml, Gel Root Canl Prep Watr Sol Lub 15to17per Edta Tube Of 3 To5gm, Abrasive Mounted Diamond Fg 801by018 Round, Abrasive Mounted Diamond Fg 807 Inverted Cone 807by016, Abrasive Mounted Diamond Fg 835 Cylindrical 835by012, Mirror Mouth Plain Glass Fig 5 Top For, Patients Bib Plastic, Tips Saliva Ejector Disposable, Calc Hydrox With Iodofomroot Canal Dresng And Filling In Syringe Of 2to4gm, Boxdenture And Appliance, Mta Pack Of 2to3 Gm, Bur Surgicaloral Round Tungsten Carbide For Straight Hand Piece, Bursurgical Oral Tapered Fissure Tungsten Carbide For Straighthand Piece, Prophylaxis Paste Jar Of 340 Gm, Dental Restokit Photo Cure Comp 4 Comp Syr Of Diff Shade Comp Shadeguide, Material Temporary Filling No Mix Single Phase Bottof 25 To 30 Gm, Medicaments Root Sodtohypo 2per, Outfitmatrix Ss Siqveland Bands Narrow For Packet Of 12, K Filesstainless Steel Size No 10 Length 25 Mm Set Of 6, Hyflex Cmrotary Files 6per Size To 20 Length 25mm, Hyflex Cm Rotaryfiles 6per Size To 25 Length 25mm, Hyflex Cm Rotary Files6per Size To 30 Length 25mm, Hyflex Cm Rotary Files 4persize To 20 Length 25mm, Hyflex Cm Rotary Files 4per Size To25 Length 25mm, Hyflex Cm Rotary Files 6per Size To 20length 21mm, Hyflex Cm Rotary Files 6per Size To 25 Length21mm, Hyflex Cm Rotary Files 6per Size To 30 Length 21mm, Hyflex Cm Rotary Files 4per Size To 20 Length 21mm, Hyflex Cm Rotary Files 4per Size To 25 Length 21mm, Burdiamond Tapered, Gauze Absorbent Folded 2point5 Cm X100 Metres, Silk Braided Size 3to0 70to76 Cm Rb 1by2circle Needle 20to25 Mm, Niti Kto File Size To10 Lto21mm, Niti Kto File Size To15 Lto21mm, Niti Kto File Size To15lto25mm, Niti Kto File Size To20 Lto21mm, Niti Kto File Sizeto20 Lto25mm, Niti Kto File Size To25 Lto21mm, Niti Ktofile Size To25 Lto25mm, Niti Kto File Size 15to40 Lto25mm, Disposable Paper Glass 200ml, Gp Points Corresponding Tohyflex Cm, Paper Points Corresponding To Hyflex Cm, Choline Salicylate Benzakonium Chloride And Lignocain Hclgel Tube Of 15gm, Intra Dental Brush, Dental Floss, Metapex Plus Double Pkt Of 2 Syringe, Giletine Sponge, Periodontal Plus Ab, Tofflemire, Cold Mould Seal Bottle Of450 Ml, Frusemide 40 Mg Tab, Frusemide 20 Mg 2 Ml Inj, Tramadol Hcl 50mgbyml Inj 1ml Amp, Lignocaine Hcl 2percentwithout Adrenaline 30 Mlsuitable For Opthalmic Usealso, Atropine Sulphate 0point6 Mg 1 Ml Inj, Adrenalinetartrate 11000 1 Ml Inj, Injectable Typhoid Vaccine0point5ml, Cell Culture Rabies Vaccine Vial Of 1ml, Etophylline Bp 84point7 Mg And Theophylline Ip 25point3mg Per Ml 2 Ml Inj, Vit Dto3 60000 Iu Per 1 Gm Sachet, Cellpack 20ltr, Diclofenac Diethylamine 2point32per Spray Fortopical Use, Tab Calcium Carbonate 500mg Plus Vit D3 500iu, Levo Salbutamol Sulphate 2point5ml Containing1point25mg Respule, Dexamethasone Sod Phos 4point4 Mg4 Mgper Ml 2 Ml Inj, Multi Vit Inj Im 2to10 Ml With Min B1b6 1to30mg Per Ml B12 300mcg Per Ml, Levo Salbutamol1point25mg Plus Ipratropium 500mcg Respule In 2point5mlrespule, Tab Isosorbide Dinitrate 10mg

Ref. Document
View Tender
#TBR: 35621571 Closed

Security Services

  • Haryana
  • Due On: 24 Oct, 2025 (0 Days Left)

Gem Bids For Atropine Sulphate 0 Point 6 Mg 1 Ml Inj, Midazolam 5 Mg 1ml Inj, Paracetamol With Cysteine Hcl Monohydrateinfusion 1000mg Per 100ml, Fentanyl 50mcg Per Ml 10 Mlinj, Nor Adrenaline Bitartrate 2 Mg Per Ml 2 Ml Inj, Lorazepam 2mg Per Ml 2 Ml Inj, Ondansetron 2mg Per Ml 4ml Inj, Tranexamic Acid 500 Mg Per 5ml Inj, Dopamine Hcl40 Mg Per Ml 5ml Inj, Dobutamine Hcl 250 Mg 5 Ml Inj, Streptokinase 15 Lac Iu Inj, Frusemide 20 Mg 2 Ml Inj, Ranitidine Hcl 50 Mg 2 Ml Inj, Metoclopramide Hcl 5mg Perml 2ml Inj, Hyoscine Bromide Inj 20 Mg Per Ml 1ml Inj, Atracurium 10 Mg Per Ml 2 Point 5 Ml Inj, Glycopyrrolate 0point 2 Mg Per Ml 1ml Inj, Neostigmine 0 Point 5 Mg 1 Mlinj, Succinylchloline Chloride 50 Mg Per Ml 2 Ml Inj, Sodium Bicarbonate 7 Point 5 Percent Amp Of 10 Ml, Calcium 9mg Plus Calcium Gluconate 50mg Inj For Iv Use 10ml Injection, Ceftriaxone 1gm Inj, Gentamycin Sulphate Injim Iv 40mg Per Ml 2 Ml Inj, Tetanus Toxoid Purifiedabsorbed Vaccine 0 Point 5ml, Cell Culture Rabies Vaccinevial Of 1ml, Human Rabies Immune Globulin 150 Iu Per Ml 2ml Pfs, Inj Phenytoin Sodium 50mg Per 2ml Amp, Morphine15 Mg 1 Ml Inj, Pethedine 50 Mg 1 Ml Inj, Adrenalinetartrate 1 Isto 1000 1 Ml Inj, Dexamethasone Sodiumphosphate 4 Point 4 Mg 2 Ml Inj, Hydrocortisone Sodiumsuccininate 100 Mg Inj, Pheniramine Maleate Inj 22 Point75 Mg Per Ml Amp Of 2 Ml, Diazepam 10 Mg 2 Ml Inj, Adenosine 3 Mg Per Ml 2 Ml Inj, Amiodarone Hcl 150 Mg 3ml Inj, Lignocaine Hcl Solution 2 Percent For Iv Use 50 Ml Inj, Labetalol Hcl 5mg Per Ml 4ml Inj, Dicyclomine Hcl 20mginj, Etophylline Bp 84 Point 7 Mg And Theophylline Ip 25point 3 Per Ml 2 Ml Inj, Dextrose Inj 25 Percent 25 Ml Inj, B1 50 Mg Inj, B 12 500 Mcg Per Ml Inj, Multi Vit Inj Iv 2 To10 Ml, Amikacin Sulphate 250mg Per 2 Ml Inj, Hepatitis Bvaccine 10 Ml  /bid Number: Gem/2025/b/6710580* /dated: 13-10-2025  & & / Bid Document1 / 33

Ref. Document
View Tender
#TBR: 35610475 Live

Education And Research Institutes

  • Uttaranchal
  • Due On: 03 Nov, 2025 (3 Days Left)

Custom Dna Synthesis Of Primers 25 Nmol , Prime Script 1st Strand Cdna Synthesis Kit 50 Reactions , Tb Green Pre Mix Ex Taq Ii Tli Rnase H Plus , Rnaiso Plus Total Rna Extraction Reagent , Amylase From Bacillus Licheniforms , Amyloglucosidase From Aspergillus Niger Lyophilized Powder 70 U Mg , Glucose Oxidase Form Aspergillus Niger Type Vii Lyophilized Powder 100000 Units G Solid Without Added Oxygen , Peroxidase From Horseradish Type Ii Essentially Salt Free Lyophilized Powder 150 250 Units Mg Solid Using Pyrogallol , Primers Forward Revers Total Base 1249 , Fish Immunoglobulin M Ig Elisa Kit 96t , Superoxide Dismutase Sod Elisa Kit , Fish Lysozyme Renal Amyloidosis Lzm Elisa Kit , Fish Interleukin 6 Il 6 Elisa Kit , Fish Cortisol Elisa Kit , Forward Primers , Reverse Primer , Taq Dna Polymerase , Ezassay Antioxidant Activity Estimation Kit Cuprac 200 Tests , Azo M Protein Azo Casein , Ezdetect Pcr Kit For Mycoplasma Detection Based On 16s 23s Rrna Spacer Region , Trypsin Inhibitor Powder Source Soyabean Cell Culture Tested Activity 7000baee Units Of Inhibition Mg , Coif1 5tcaaccaaccacaagacattggcac3 26 Nucleotides , Coir1 5tagacttctgggtgccaaagaatca3 26 Nucleotides , M151 5aacccggctttcggcagca3 20 Nucleotides , M152 5cggggcggggttgtgagat3 20 Nucleotides , Ihn Up F 5agagatccctacaccagagac 3 21 Nucleotides , Ihn Up R 5agagatccctacacagagac 3 21 Nucleotides , Vn F 5atggaaggaggaatcgtgaagcg 3 24 Nucleotides , Vn R 5

16.98 Lacs
View Tender
#TBR: 35607683 Closed

Security Services

  • Delhi
  • Due On: 28 Oct, 2025 (0 Days Left)

Gem Bids For Micro Tips Pp Autoclavable 0 Point 2 To 10ul 1000 Per Pkt, Micro Tips Pp Autoclavable 2 To 200ul 1000 Per Pkt, Microtips Pp Autoclavable 200 Ul To1000ul 500 Per Pkt, Tissueculture Petridish To Sterile Ps 100mm Pkt Of 200, Tissueculture Petridish To Sterile Ps 60mm Pkt Of 500, Tissueculture Petridish To Sterile Ps 35mm Pkt Of 500, Tissueculture Flask With Filter Cap Sterile Ps25cm Pkt Of 200, Tissue Culture Flask With Filter Cap Sterile Ps75cm Pkt Of100, Centrifuge Tube Conical Bottom Pp Autoclavable 50sterile Pkt Of 500, Centrifuge Tube Conical Bottom Ppautoclavable 15 Sterile Pkt Of 500, Tissue Culture Platesterile Ps12 Wells Pkt Of 50, Tissue Culture Plate Sterile Ps6 Wells Pkt Of 50, Reagent Bottle Narrow Mouth With Screwcap Bott Of 100ml, Reagent Bottle Narrow Mouth Withscrew Cap Bott Of 250ml, Reagent Bottle Narrow Mouth Withscrew Cap Bott Of 1000ml, Fetal Bovine Serum Usa Originsterile To Filtered Suitable For Cell Culture Suitable Forhybridoma Bott Of 500ml, Collagenase From Clostridiumhistolyticum Pkt Of 1gram, Dispase Ii 1gram, Penicillinstreptomycin Solution Hybrid Max Tm Bott Of 100ml, Mescosteogenesis Kit, Adipogenesis Kit, Monoclonal Anti Cd 90to Fitc Antibody Produced In Mouse For 100 Tests, Monoclonal Anti Cd 44 Fitc Antibody Produced In Mouse For100 Tests, Monoclonal Anti Cd 34 Fitc Antibody Producedin Mouse For 100 Tests, Monoclonal Anti Cd 45 Fitcantibody Produced In Mouse For 100 Tests, Monoclonal Anticd 11b Fitc Antibody Produced In Mouse For 100 Tests, Monoclonal Anti Cd 29 Fitc Antibody Produced In Mouse For100 Tests, Monoclonal Anti Cd 73 Antibody Produced Inmouse Bott Of 100ug, Monoclonal Anti Cd 105 Fitcantibody Produced In Mouse For 100 Tests, Anti Cd 166alcam Antibody Clone Tag 1a3200 Ul, Monoclonal Anti Cd33 Fitc Antibody Produced In Mouse For 100 Tests, Bmpprotein Human Recombinant Bott Of Ug, Dulbeccos Modifiedeagles Medium Low Glucose Bott Of 500ml, Plt Maxhuman Platelet Lysate100ml    //bid Details2 / 29

10.26 Lacs
View Tender
Download Document